We narrowed to 25,670 results for: promoter
-
Plasmid#202630Purposevector for encoding an engineered glycosylase-based guanine base editor (gGBEv6.3) with SpG nickase driven by EF1a promoter, guide RNA compatible with SpG driven by hU6, mCherry driven by CBh promoterDepositorInsertnSpG(D10A)-MPGv6.3
ExpressionMammalianMutationSpG = D1135L, S1136W, G1218K, E1219Q, R1335Q, T13…PromoterhU6, EF1a, CBhAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
RMCE halo-flag DNA-PKcs
Plasmid#233918PurposeLow copy number provides expression of human DNA-PKcs with an N-terminal halo-flag tag.DepositorAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE-8XGTIIC-DsRED-DD
Plasmid#115798Purposelentiviral, trimethoprim (TMP) regulated YAP promoter activity reporterDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3 3 kb prom. CD274
Plasmid#107004PurposeModified Luciferase expression vectorDepositorAvailable SinceMarch 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
gGBEv6.3-SpCas9
Plasmid#202629Purposevector for encoding an engineered glycosylase-based guanine base editor (gGBEv6.3) with SpCas9 nickase driven by EF1a promoter, guide RNA compatible with SpCas9 driven by hU6, mCherry driven by CBh promoterDepositorInsertnSpCas9(D10A)-MPGv6.3
ExpressionMammalianMutationMPGv6.3 = G163R, N169G, D175R, C178N, S198A, K202…PromoterhU6, EF1a, CBhAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
SMARCA2-GFP
Plasmid#65390PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-hM4Di-mCherry
Plasmid#182532PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The hM4Di receptor expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene - hSyn promoter-tet-flex-hM4Di-cherry
UseAAV, Cre/Lox, and Mouse TargetingTagshM4Di-mCherryExpressionMammalianPromotertetO promoterAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX317-MBNL2
Plasmid#115444PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3 2 kb prom. CD274
Plasmid#107003PurposeModified Luciferase expression vectorDepositorAvailable SinceMarch 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniCRISPRoff-v1
Plasmid#197030PurposeVector encoding a human codon-optimized miniCRISPRoff-v1 driven by CBh promoter, guide RNAs compatible with enOsCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized miniCRISRPoff-v1
ExpressionMammalianMutationD52R / T132R / D228A / D406APromoterCBh, CMV, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGD-P1/HC-Pro
Plasmid#196328Purpose35S promoter-driven expression of the tobacco etch virus P1/HC-Pro RNA silencing suppressorDepositorInserttobacco etch virus P1/HC-Pro
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUNO mouse CD274 + 3'UTR WT full length
Plasmid#107012PurposeExpresses murine PD-L1 with the 3'UTRDepositorInsertCD274 (Cd274 Mouse)
ExpressionMammalianAvailable SinceMarch 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hLin28B
Plasmid#26358DepositorAvailable SinceNov. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.tRFP
Plasmid#57819PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Fgf4enhLV (FpG12)
Plasmid#69444Purposepositive control plasmid for lentiviral reporter expression in ESCsDepositorInsertsUseLentiviralExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-ChR2-EYFP
Plasmid#183765PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The ChR2-EYFP expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene -teto promoter-flex/dio-ChR2-EYFP
UseAAV, Cre/Lox, and Mouse TargetingTagsChR2-EYFPExpressionMammalianPromotertetO promoterAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-sgfiller-eCas9-T2A-BlastR
Plasmid#172437PurposeExpresses eCas9, BlastR and sgRNA cloning siteDepositorInsertseCas9
BlastR
UseCRISPR, Lentiviral, and Mouse TargetingAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only