We narrowed to 45,592 results for: cha;
-
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-) MID51 4xMyc Hisx6
Plasmid#44598DepositorAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGSKU
Plasmid#72243PurposeContains the CORE cassette with convergent KlURA3 and KanMX4 markers and the I-SceI gene under the inducible GAL1 promoterDepositorInsertsKlURA3
kanMX4
I-SceI
ExpressionBacterialAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEC2861 (pSpy1C-PgyrA_ffluc)
Plasmid#218511Purposereplicative E. coli-S. pyogenes shuttle plasmid, constitutive expression of firefly luciferase reporterDepositorInsertffluc
UseLuciferaseMutationdeletion of Plac_mrfp cassettePromoterPgyrAAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB123
Plasmid#68577PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsTriple repeats of Citrine (3xCitrine)ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCVL.SFFV.Kozak.HA.NLS.SceOpt.IRES.BFP
Plasmid#45574PurposeExpresses I-Sce I nuclease in mammalian cells with BFP tracker in lentiviral backboneDepositorInsertco I-Sce I
UseLentiviralTagsHA, IRES BFP, and NLSExpressionMammalianMutationco indicates codon optimization for mammalian exp…PromoterSFFVAvailable SinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-CreERT2
Plasmid#149437PurposeROSA26 targetting vector with tamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJL1-CRM197-4xDQNAT
Plasmid#128395PurposeIn vitro expression of CRM197 with C terminal 4xDQNAT glycosylation sitesDepositorInsertDiphtheria toxin
Tags4xDQNAT glycosylation tag and 6xHis tagExpressionBacterialMutationInactivating G52E mutationPromoterT7Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
TR-Csy4-H29A
Plasmid#80602PurposeExpresses Csy4 with an inactivating H29A mutation from the CBA promoter. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.DepositorInsertCsy4-H29A
UseAAVExpressionMammalianMutationHis29 mutated to AlaPromoterCBAAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
mt POLRMT
Plasmid#205059PurposePOLRMT protein expressionDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAM28
Plasmid#234314PurposepColE1 origin Cat-RNA U1376, Multiplexing ribozyme splicing reactions for the purpose of comparing host range of origins of replicationsDepositorInsertU1367 Targeting RAM, Barcode 2
UseSynthetic BiologyPromoterP. CymRCAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-hAgo2
Plasmid#11590DepositorAvailable SinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-ZmBbm-P2A-ZmWus2-9
Plasmid#197750PurposePhytobrick (MoClo) Level 0 PartDepositorInsertZmBbm-P2A-ZmWus2 bicistronic CDS
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB103
Plasmid#68557PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-Ruby-9
Plasmid#197740PurposePhytobrick (MoClo) Level 0 PartDepositorInsertRuby reporter tricistronic CDS
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF-CjPglB
Plasmid#199305PurposepSN18 derivative encoding C.jejuni PglB with C-terminal FLAG epitope tagDepositorInsertCjPglB with flag tag
TagsFlag tagExpressionBacterialPromoterpBADAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB102
Plasmid#68556PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEC3105 (pSpy1C-PxylS2_ffluc)
Plasmid#218512Purposereplicative E. coli-S. pyogenes shuttle plasmid, constitutive expression of firefly luciferase reporterDepositorInsertffluc
UseLuciferaseMutationdeletion of Plac_mrfp cassettePromoterPxylS2Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only