We narrowed to 19,856 results for: IRE;
-
Plasmid#37232DepositorTagsGST and His6ExpressionBacterialPromoterT7Available SinceSept. 4, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-Zyxin-Full Length (aa1-564)-EGFP
Plasmid#187692PurposeVisualization of ZyxinDepositorAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL0426 (CRISPR with spc3)
Plasmid#130642PurposeExpresses CRISPR RNA from a T7 promoter for VchCAST system. The CRISPR array encodes a guide RNA with spacer 3 from the native CRISPR.DepositorInsertCRISPR(spacer-3)
UseCRISPR; TransposonExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p3XFLAG-MKL1-~100
Plasmid#27176DepositorAvailable SinceDec. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-His-TEV-OTC_Ub
Plasmid#172134PurposeScaffold design for studying ubiquitin interacting proteins by cryo-EM.DepositorInsertE. coli ornithine transcarbamylase (OTC), fused to human ubiquitin
Tags6xHis-TEVExpressionBacterialPromoterT7Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsXRN1_1-1173_K
Plasmid#146785PurposeMammalian Expression of HsXRN1_1-1173DepositorInsertHsXRN1_1-1173 (XRN1 Human)
ExpressionMammalianMutationone silent mutation compared to the sequence give…Available SinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-1
Plasmid#172767PurposeBacterial expression of anti-mCherry nanobody LaM-1, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-1
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag6-iCAM-1
Plasmid#205210PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG6DepositorInsertsynCAM iCAM1 and Lag6 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag18-iCAM-1
Plasmid#205207PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG18DepositorInsertsynCAM iCAM1 and Lag18 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag42-iCAM-1
Plasmid#205205PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG42DepositorInsertsynCAM iCAM1 and Lag42 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBEAST-pBen-Luc
Plasmid#122694PurposeOutput expression of firefly luciferase under the activation of BenR transcription factor for cell-free expressionDepositorInsertFirefly luciferase
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-FRT-TO-GFP-PALB2 KR
Plasmid#71107Purposemammalian expression of GFP-PALB2 mutant. (first 8 Lysine residues mutated to Arginine)DepositorInsertPALB2 (PALB2 Human)
TagsGFPExpressionMammalianMutationfirst 8 Lysine residues mutated to Arginine (K14-…PromoterCMV/TOAvailable SinceDec. 2, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-N3/hArf1(WT)-EGFP
Plasmid#79413PurposeExpresses C-terminally EGFP-tagged Arf1(WT) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3/hArf3(WT)-EGFP
Plasmid#79418PurposeExpresses C-terminally EGFP-tagged Arf3(WT) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWL89A mmPing20
Plasmid#145788PurposemPing Yeast Transposition AssayDepositorInsertmmPing20
ExpressionYeastMutationT162C, T258A, T287C, T300A, T304A, T310A, G372AAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-29
Plasmid#172753PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-29; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-29
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-21
Plasmid#172749PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-21; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-21
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-37
Plasmid#172756PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-37; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-37
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRG36-ChAT
Plasmid#99069PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea ChAT (choline acetyltransferase)DepositorInsertChAT (choline acetyltransferase) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only