We narrowed to 16,665 results for: grn
-
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ctrl)
Plasmid#69215PurposeAdvanced lentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; control, MLL-sgRNA + luciferase-sgRNADepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV promoter
P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Hygro-sgSIK3
Plasmid#138699PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75232PurposeCRISPR/Cas9 plasmid against human NFATc2DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW1883
Plasmid#154331PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgLKB1-A
Plasmid#138663PurposeExpresses a mouse LKB1-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
px335-EF-Slc2a3-L
Plasmid#122304PurposeExpresses sgRNA targeting mouse Slc2a3 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Slc2a3 (Slc2a3 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK2
Plasmid#138696PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK3
Plasmid#138697PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_RAF1_94
Plasmid#111826PurposeKnockout Raf1DepositorInsertgRNA targeting RAF1 94-114 (RAF1 Human)
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1850
Plasmid#154328PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1882
Plasmid#154330PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFB-Puro-B
Plasmid#192507PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInsertbU6-sgRNACR2-CS-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterbU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN098
Plasmid#91625PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC77
Plasmid#62338PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only