We narrowed to 23,729 results for: nsf
-
Plasmid#126454PurposeExpresses Cas9-XTEN-dTdT in mammalian cells.DepositorInsertCas9-XTEN-dTdT (DNTT Human, Streptococcus pyogenes)
ExpressionMammalianMutationAdded D343E and D345E to inactivate TdT.PromoterCMVAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBiex1-SYNAC
Plasmid#82710PurposeSynthetic soluble adenylyl cyclase FRET sensor and cAMP generatorDepositorTagsFLAG, mCerulean, and mCitrineExpressionBacterial and InsectPromoterT7Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-mVenus-FLAG-LANS1-Set2
Plasmid#122003PurposemVenus-FLAG-LANS-Set2: mVenus- and FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInsertmVenus-FLAG-LANS1-Set2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsmVenus-FLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-EGFP
Plasmid#237858PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-cOpn5-T2A-mcherry
Plasmid#238009PurposeThe transfer plasmid for packaging AAV expressing Cre-dependent chicken OPN5 was constructed by inserting the OPN5 coding sequence into the multiple cloning site under the control of EF1α promoterDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3A_bGHpA
Plasmid#177349PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-hCIT K42E
Plasmid#203168PurposeYeast expression vector for human DHDDS K42EDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT22UbhaEng2aE4PCh(#271)
Plasmid#184085Purposecyclofen-inducible fish Eng2a (wt) activation in zebrafish permanent transgenicDepositorInsert3HA-ZfEng2a-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags3xHAMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22UbhaEng2bE4PCh(#272)
Plasmid#184086Purposecyclofen-inducible fish Eng2b (wt) activation in zebrafish permanent transgenicDepositorInsert3HA-ZfEng2b-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags3xHAMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22gCfpUbm5En2E4PCh(#251)
Plasmid#184083Purposecyclofen-inducible chicken EN2 (wt) activation in zebrafish permanent transgenicDepositorInsert5myc-chkEn2-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22Ubm5Eng2bE4PCh(#284)
Plasmid#184088Purposecyclofen-inducible fish Eng2b (wt) activation in zebrafish permanent transgenicDepositorInsert5myc-ZfEng2b-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22UbHEn2E4PCh(#262)
Plasmid#184084Purposecyclofen-inducible chicken EN2 (wt) activation in zebrafish permanent transgenicDepositorInsert3HA-chkEn2-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags3xHAMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22Ubm5Eng2aE4PCh(#283)
Plasmid#184087Purposecyclofen-inducible fish Eng2a (wt) activation in zebrafish permanent transgenicDepositorInsert5myc-ZfEng2a-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
His6-EGFP-cPHx1
Plasmid#183674PurposePtdIns(3,4)P2 biosensor for purification from bacteriaDepositorInsertPLEKHA1 (PLEKHA1 Human)
TagsHis6-EGFPExpressionBacterialMutationAmino acids 169-329PromoterT7Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Joint Modular Cloning (JMC) Toolkit
Plasmid Kit#1000000233PurposeModular cloning chassis and set of functional parts for assembling plant transformation vectors, compatible with MoClo.DepositorApplicationCloning and Synthetic BiologyVector TypePlant ExpressionCloning TypeGolden GateAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-FLp300
Plasmid#61356Purposeencodes S. pyogenes dCas9 with c-terminal fusion of FL human p300 (aa 2-2414) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal full length human p300 (aa 2-2414) (EP300 Human, S. pyogenes, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSF_his6_sumo_SARS_CoV2_NSP14
Plasmid#213518PurposeExpresses NSP14 of SARS-CoV-2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only