We narrowed to 27,806 results for: gfp
-
Plasmid Kit#1000000156PurposeLibrary of standardized chloroplast-specific genetic modules for Golden-Gate cloning of synthetic operons into chloroplast transformation vectors.DepositorApplicationCloning and Synthetic BiologyVector TypePlant ExpressionCloning TypeGolden Gate (MoClo)Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CaMKII-SomArchon
Plasmid#126942PurposeExpression of SomArchon under CaMKII promoterDepositorInsertSomArchon
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-alpha
Plasmid#88846PurposeCRISPR KO of Trp53DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Human lentiviral CRISPR library_v1
Pooled Library#69763PurposeUsed for genome scale lentiviral CRISPR screening. Target sites were chosen in a region close to the translation initiation site.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTitin
Plasmid#26428DepositorInsertpartial sequence of mouse Titin
UseLentiviralAvailable SinceNov. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
-
p426 25Q GAL
Plasmid#1187DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-huKC2-IGR21
Plasmid#59456PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the human keratin type II cluster.DepositorInserthuKrt1 3’intergenic region
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-GFP-MYC
Plasmid#185375PurposeFor mammalian expression of human GFP-MYCDepositorAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLP-hSox2-ires-gfp
Plasmid#49391Purposemammalian bicistronic expression of human Sox2 and EGFPDepositorInsertSox2 (SOX2 Human)
UseCre/Lox; Acceptor vectorTags6xHN, EGFP, and IRESExpressionMammalianMutationTGA (stop) to CCA (Pro) at nt 1027 with respect t…PromoterCMVAvailable SinceDec. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1zetaYF1-6
Plasmid#109295PurposeExpress TCR zeta-GFP fusion proteinDepositorAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mGFP-llo190-mc38minor
Plasmid#174604Purposeexpresses palmitoylated GFP with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes Aatf, irgq and cpne1DepositorInsertpalmitoyl-GFP C-term fusion LLO190 and minigenes of 3 neoantigens from MC38 tumor in genes Aatf irgq cpne1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-GFP-Sec61β
Plasmid#186597PurposeThird generation lentiviral vector expressing GFP-Sec61βDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-DeltaRBP
Plasmid#135999PurposeG3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminusDepositorInsertG3BP1 (G3BP1 Human)
TagsEGFPExpressionMammalianMutationC-term of G3BP1 Deleted for Delta RBPAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-CMV-GFP
Plasmid#128065PurposeAdenoviral shuttle vector with CMV promoter-EGFPDepositorInsertCMV promoter-EGFP
UseAdenoviralMutationnoAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-GFP-human cGASdeltaN
Plasmid#186880PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal GFP fusion (Adamts1 Synthetic, Human)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-GFP
Plasmid#186845PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal GFP fusion (Adamts1 Synthetic, Human)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pE-cadherin-GFP-N-WASP deltaVCA
Plasmid#101283PurposeMammalian expression of E-cadherin-GFP-N-WASP delta VCADepositorTagsGFPExpressionMammalianMutationdelta VCA domainAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only