We narrowed to 20,191 results for: IRE
-
Plasmid#198175PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-3 μ3B fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-3 μ3B
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCPP3417
Plasmid#128724PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopY1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Pou4f3
Plasmid#158530PurposeExpresses human Pou4f3 in mammalian cellsDepositorAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-26
Plasmid#172751PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-26; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-26
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL0426 (CRISPR with spc3)
Plasmid#130642PurposeExpresses CRISPR RNA from a T7 promoter for VchCAST system. The CRISPR array encodes a guide RNA with spacer 3 from the native CRISPR.DepositorInsertCRISPR(spacer-3)
UseCRISPR; TransposonExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-ExSYTE
Plasmid#216263PurposeCre-dependent expressoin of ExSYTE (P2A) EGFP with 3'UTR of Rat Arc DTE under synapsin promoterDepositorInsertExSYTE P2A EGFP - Rat DTE
UseAAVAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDUP1
Plasmid#223516Purposeinactive cogfp under control of Ptet, cogfp under control of PtacDepositorInsertsCoGFP
CoGFP inactivated
TagsHis tagExpressionBacterialMutationanti-dimerization mutations S129G, 22 C154S, D156…PromoterPtac, Ptac and Ptet, and PtetAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-1
Plasmid#172767PurposeBacterial expression of anti-mCherry nanobody LaM-1, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-1
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsXRN1_1-1173_K
Plasmid#146785PurposeMammalian Expression of HsXRN1_1-1173DepositorInsertHsXRN1_1-1173 (XRN1 Human)
ExpressionMammalianMutationone silent mutation compared to the sequence give…Available SinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_1
Plasmid#106316PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCit-APPAP-gs
Plasmid#228090PurposeMammalian expression of five coiled coil segments in APPAP arrangment, with short flexible linkers and N-terminal mCitrine; for phase separation and forming of liquid condensates in mammalian cells.DepositorInsertmCit, APPAP
ExpressionMammalianAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-29
Plasmid#172753PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-29; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-29
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3/hArf3(WT)-EGFP
Plasmid#79418PurposeExpresses C-terminally EGFP-tagged Arf3(WT) in mammalian cellsDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-MYB-3'UTR
Plasmid#25798DepositorAvailable SinceJuly 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZeo-Cas9-gate
Plasmid#113744PurposeGateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving Zeocin for selection in plants.DepositorInsertCas9
UseCRISPR; Gateway destination vectorPromoterZ. Mays ubiquitin promoter, 35S promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pBEAST-pBen-Luc
Plasmid#122694PurposeOutput expression of firefly luciferase under the activation of BenR transcription factor for cell-free expressionDepositorInsertFirefly luciferase
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C2-TetR-KRf-TetR
Plasmid#216270PurposeConstruct 3: TetR - Lipid binding domain KRφ - TetRDepositorInsertTetR - Lipid binding motif (KRf) - TetR
TagsEGFPExpressionMammalianAvailable SinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-His-TEV-OTC_Ub
Plasmid#172134PurposeScaffold design for studying ubiquitin interacting proteins by cryo-EM.DepositorInsertE. coli ornithine transcarbamylase (OTC), fused to human ubiquitin
Tags6xHis-TEVExpressionBacterialPromoterT7Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only