We narrowed to 15,448 results for: NTS
-
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-NTEV-TCS-GV-2xHA
Plasmid#194371PurposeSplit TEV assaysDepositorInsertSP-AVPR2-NTEV-TCS-GV-2xHA (AVPR2 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-GLP1R-NTEV-TCS-GV-2xHA
Plasmid#194379PurposeSplit TEV assaysDepositorInsertSP-GLP1R-NTEV-TCS-GV-2xHA (GLP1R Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-NTEV-TCS-GV-2xHA
Plasmid#194359PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194360PurposeSplit TEV assaysDepositorInsertDRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD2-NTEV-TCS-GV-2xHA
Plasmid#194362PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet1-6xHis-TEV-OPTN
Plasmid#190192PurposePlasmid for the expression of 6xHis-TEV-OPTN. Internal reference: SMC397DepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-GB1-EWS_171-264
Plasmid#180466PurposeExpresses the construct His8-GB1-EWS_171-264 with a TEV cleavage site between GB1 and EWS_171-264DepositorInsertEWSR1 (EWSR1 Human)
TagsGB1 and His8ExpressionBacterialMutationdeleted 1-170, 265-656PromoterT7Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-GFP-EWS_1-120
Plasmid#180464PurposeExpresses the construct His8-GFP-EWS_1-120 with a TEV cleavage site between GFP and EWS_1-120DepositorInsertEWSR1 (EWSR1 Human)
TagsGFP and His8ExpressionBacterialMutationdeleted 121f-656PromoterT7Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetP-HsEDC3_192-508-GST-HsRCK_E
Plasmid#146214PurposeBacterial Expression of HsEDC3_192-508-HsRckDepositorInsertHsEDC3_192-508-HsRck (EDC3 Human)
ExpressionBacterialAvailable SinceFeb. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP72-RBM8A-3'UTR AluY-Sz mut 2598-4066
Plasmid#175586Purposein vitro transcription of mut RBM8A 3'UTRDepositorInsertRBM8A-3'UTR AluY-Sz mut 2598-4066
UseIn vitro transcriptionPromoterT7Available SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
VHACg/pDONR221
Plasmid#172094PurposeGenomic fragment containing the upstream region and coding region of DET3/VHA-C cloned into pDONR221DepositorInsertVHA-C genomic region including 530bp upstream of the ATG, exons, introns, and no stop codon (DET3 Mustard Weed)
UseGateway entry vectorPromoter530bp upstream of VHA-C ATGAvailable SinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-3xFLAG-Puro PAK5 K478R/479R S364L
Plasmid#167199Purposepuromycin resistant lentiviral vector for expression of PAK5 K478R/479R S364L; PAK7 Kinase dead & S364L double mutantDepositorInsertPAK5 K478R/479R S364L
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-3xFLAG-Puro PAK5 K478R/479R D421N
Plasmid#167200Purposepuromycin resistant lentiviral vector for expression of PAK5 K478R/479R D421N; PAK7 Kinase dead & D421N double mutantDepositorInsertPAK5 K478R/479R D421N
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-3xFLAG-Puro PAK5 K478R/479R E294K
Plasmid#167198Purposepuromycin resistant lentiviral vector for expression of PAK5 K478R/479R E294K; PAK7 Kinase dead & E294K double mutantDepositorInsertPAK5 K478R/479R E294K
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-3xFLAG-Puro PAK5 K478R/479R M173I
Plasmid#167197Purposepuromycin resistant lentiviral vector for expression of PAK5 K478R/479R M173I; PAK7 Kinase dead & M173I double mutantDepositorInsertPAK5 K478R/479R M173I
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-3xFLAG-Puro PAK5 K478R/479R E144K
Plasmid#167196Purposepuromycin resistant lentiviral vector for expression of PAK5 K478R/479R E144K; PAK7 Kinase dead & E144K double mutantDepositorInsertPAK5 K478R/479R E144K
UseLentiviralExpressionMammalianPromoterUBCAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV126
Plasmid#124250PurposeIn vitro transcription plasmid for T7 transcription of wildtype Her2 sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV127
Plasmid#124251PurposeIn vitro transcription plasmid for T7 transcription of Her2 ITD sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only