173,176 results
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI-myc-USP10
Plasmid#184034PurposeExpresses myc-USP10 construct in mammalian cellsDepositorAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiRTi
Plasmid#214068PurposeFluorescent reporter system to measure EJC-enhanced NMD activity. Intron present in 5'UTRDepositorInsertTurboRFP
ExpressionMammalianMutationLinker sequence present between RFP and GFPAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-ETV6
Plasmid#131594Purposedoxycycline-inducible expression of human ETV6 in mammalian cellsDepositorAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLyGo-Bs-1
Plasmid#163137PurposepLyGo cloning vector for a sequence of interest (LPMO) in Bacillus subtilis. Vector encoding the AmyL signal peptide and the LyGo casette (SapI-ccdB-SapI)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterPamyL-PamyQ-PcryIIIA-cryIIIAstab49Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-SREBP-2
Plasmid#26807DepositorInsertSterol Regulatory Element Binding Protein 2 (SREBF2 Human)
Tags2x FLAGExpressionMammalianMutationL7V, G76S, K395R and I482LPromoterCMVAvailable SinceJuly 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8m-WPRE (AAV5)
Viral Prep#162378-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-FLEX-jGCaMP8m-WPRE (#162378). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8m-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR-HA-IKKbeta
Plasmid#15470DepositorAvailable SinceOct. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP12-5ptpase domain
Plasmid#67516PurposeRecruitable human type IV 5-phosphatase domain (214-644)DepositorTagsmRFPMutationINPP5E has C641A to destroy the C-terminal CAAX d…Available SinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLIK DNM1L-V5 neo
Plasmid#220363PurposeLentiviral expression vector for an inducible V5-tagged DNM1L constructDepositorAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only