We narrowed to 51,523 results for: ina
-
Plasmid#90239PurposeLentiviral vector to express JNK KTR EE (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (EE mutant)
UseLentiviralTagsmCloverExpressionMammalianPromoterPGKAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hBTC
Plasmid#199230PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Unc5b.a-Fc-His
Plasmid#72178PurposeExpresses the extracellular region of the Unc5B, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK2-2A-mCherry
Plasmid#118285PurposeExpresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Dyrk2 Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-Fc-His
Plasmid#72136PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-(STChRger2-TS-EYFP)
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.b-AP-His
Plasmid#71995PurposeExpresses the extracellular region of the Netrin G2, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-Fc-His
Plasmid#72138PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
HA-PRAS40 AA
Plasmid#86759PurposeN-terminal HA-tagged protein expression in mammalian cellsDepositorInserthuman PRAS40 (AKT1S1 Human)
TagsHAExpressionMammalianMutationAA (S183A, S221A)PromoterCMVAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK3-2A-mCherry
Plasmid#118287PurposeExpresses mouse DYRK3 tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 (Dyrk3 Mouse)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.a-AP-His
Plasmid#71984PurposeExpresses the extracellular region of the Netrin G1, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
BMR1_01g02031-bio-His
Plasmid#108116Purpose[Edit] Expresses enzymatically monobiotinylated full-length BMR1_01g02031 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tagDepositorInsertBMR1_01g02031
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-deSpCas9-VP64-6xHis
Plasmid#92117PurposeExpression of dead/inactive increased fidelity eSpCas9 (1.1)-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive eSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, H840A, K848A, K1003A, R1060APromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP10-bio
Plasmid#47719PurposeExpresses enzymatically monobiotinylated full-length MSP10 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP10
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Neo1.a-Fc-His
Plasmid#72089PurposeExpresses the extracellular region of the Neogenin 1, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-Fc-His
Plasmid#72161PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 GW-mCit-PA
Plasmid#113449PurposeProteinA-mCitrine Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsmCitrine-ProteinAExpressionMammalianPromoterCMVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only