We narrowed to 21,843 results for: SPR
-
Plasmid#69220PurposeExpresses wild type SpCas9 in mammalian cellsDepositorInsertSpCas9
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX544 SpCas9(del1098-1368)
Plasmid#58889PurposeTruncated form of SpCas9 without C' domainDepositorInserthSpCas9
UseCRISPRTags3XFLAGExpressionMammalianMutationdel amino acids 1098-1368Available SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX543 SpCas9(del175-307)
Plasmid#58888PurposeTruncated form of SpCas9 without REC2 domainDepositorInserthSpCas9
UseCRISPRTags3XFLAGExpressionMammalianMutationdel amino acids 175-307Available SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPD0035_CROPseq-CAR-Puro_CD19-28z
Plasmid#242983PurposeCD19-28z FMC63 CARDepositorInsertCD19-28z FMC63 CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PEmax-P2A-EGFP
Plasmid#240534PurposeFor lentiviral expression of PEmax with EGFPDepositorInsertPEmax-P2A-EGFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
PECAM1-mRuby3-T2A-secNluc
Plasmid#235607PurposeDonor plasmid for knock-in of mRuby3-T2A-secNluc into the human PECAM1 locusDepositorInsertPECAM1 homologous recombination arms with PuroR drug selection cassette
UseCRISPRAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDM069
Plasmid#216821PurposeAspergillus nidulans codon-adjusted mStayGold2 fluorescent protein, includes linker for N-terminal tagging.DepositorInsertmStayGold2
TagsRIPGLIN and VinnyLinkerExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK466 (mAB-BSD)
Plasmid#214392PurposemAID-BromoTag for C-terminal taggingDepositorInsertmAID-BromoTag-BSD
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NANOS3_cterm
Plasmid#222904PurposeCas9/sgRNA plasmid for targeting NANOS3DepositorInsertCas9, NANOS3 sgRNA (NANOS3 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-TRE3G-TdTomato
Plasmid#192658PurposeA plasmid encoding TRE3G sgRNA and TRE3G-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, TRE3GAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70CT5-PxylR-CymR, Pveg(CuO)-LacZ
Plasmid#191627PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5 (engineered from pCT5-bac2.0)-LacZDepositorInsertlacZ
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-VP64-dCas9-VP64-ZsG
Plasmid#192667Purpose3rd generation lenti vector encoding VP64-dCas9-VP64 with 2A ZsGreen1DepositorInsertVP64-dCas9-VP64, ZsGreen1
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cERb447
Plasmid#188257PurposePlasmid ensures constitutive expression of the C-terminal fragment of split ERbeta (aa 447-501), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cTRb413
Plasmid#188261PurposePlasmid ensures constitutive expression of the C-terminal fragment of split TRbeta (aa 413-460), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBEC8
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_hPGK1_mScarlet-I-TOSI_Donor
Plasmid#178087PurposeHDR donor plasmid to introduce the mScarlet-I mTOR signaling indicator (TOSI) cassette to AAVS1 using AAVS1 T2 sgRNA.DepositorInsertmScarlet-I mTOR signaling indicator (TOSI)
UseCRISPRExpressionMammalianPromoterHuman PGK1Available SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEC581
Plasmid#174369PurposeRFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.DepositorInsertRFP with PAM rich sequence upstream promoter
UseSynthetic BiologyExpressionBacterialPromoterJ23117Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-STU
Plasmid#138110PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized LbCas12a without promoter and terminatorDepositorInsertLbCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only