We narrowed to 11,589 results for: aga
-
Plasmid#195103PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_1
Plasmid#86299PurposeEncodes gRNA for 3' target of human FOXP1DepositorInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-phoA
Plasmid#207991PurposeCRISPR vector used with pAf-CRISPR-ctfR1 (#207992) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertphoA
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
plKO.1-DNAJC5-ShRNA
Plasmid#205729PurposeKnockdown of DNAJC5DepositorInsertshRNA targeting DNAJC5 (DNAJC5 Human)
UseLentiviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA-1045C
Plasmid#125005PurposeExpresses gRNAs targeting hid, eve, and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.1
Plasmid#78536PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-SETDB1_2
Plasmid#36348DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_2
Plasmid#86300PurposeEncodes gRNA for 3' target of human FOXP1DepositorInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-DNMT3A_1
Plasmid#36380DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGAM1_sgRNA2
Plasmid#201615PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
WEE1 F10.4 gRNA
Plasmid#90941Purpose3rd generation lentiviral gRNA plasmid targeting human WEE1DepositorInsertWEE1 (Guide Designation F10.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
WEE1 F9.4 gRNA
Plasmid#90940Purpose3rd generation lentiviral gRNA plasmid targeting human WEE1DepositorInsertWEE1 (Guide Designation F9.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
POT1 E3.4 gRNA
Plasmid#90842Purpose3rd generation lentiviral gRNA plasmid targeting human POT1DepositorInsertPOT1 (Guide Designation E3.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
SMC3 A8.4 gRNA
Plasmid#90897Purpose3rd generation lentiviral gRNA plasmid targeting human SMC3DepositorInsertSMC3 (Guide Designation A8.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
SMC3 A7.4 gRNA
Plasmid#90896Purpose3rd generation lentiviral gRNA plasmid targeting human SMC3DepositorInsertSMC3 (Guide Designation A7.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
SMC3 H8.1 gRNA
Plasmid#90895Purpose3rd generation lentiviral gRNA plasmid targeting human SMC3DepositorInsertSMC3 (Guide Designation H8.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pS23.U6<ActB.mus_C-term-KI_gRNA
Plasmid#207408PurposegRNA from a U6 promoter targeting the mouse ActB near the 3' end of the ORF. Used for C-terminal knockin by DSB repair. [Lab plasmid ID: TU260]DepositorInsertActB
UseCRISPR and Mouse TargetingPromoterU6Available SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only