We narrowed to 962 results for: GGCT;
-
Plasmid#125515PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
Plasmid#242662PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and mouse gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (human) (LLH301)
Plasmid#242661PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and human gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_human_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 rs58692659-guide1
Plasmid#125509PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs58692659 (ZFAND3 GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs58692659-guide1
Plasmid#125452PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs58692659 (ZFAND3 GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 GLIS3 TSS-guide2
Plasmid#118189PurposeCRISPR-mediated activation of GLIS3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 GLIS3 TSS-guide1
Plasmid#118188PurposeCRISPR-mediated activation of GLIS3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide2
Plasmid#118174PurposeCRISPR-mediated repression of GLIS3. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Musunuru-Cowan TALEN Kit
Plasmid Kit#1000000034PurposeUsed to efficiently assemble TALEN constructs with custom repeat arrays, each containing 15 repeats. Contains pre-assembled trimer and tetramer RVD domains designed for rapid TALEN assembly.DepositorAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
SB39
Bacterial Strain#235121PurposeE. coli strain suitable for cloning, expression, library construction (good electroporation yield) and quantitative bacterial two-hybrid (qB2H).DepositorBacterial ResistanceNoneAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ekker Lab TALEN kit
Plasmid Kit#1000000038PurposeContains all 256 possible combinations of pFUS_B4 clones for Golden Gate assembly of 15-RVD TALENs for high-throughput mutagenesisDepositorAvailable SinceMarch 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
TB204 △metB
Bacterial Strain#229549PurposeFluorescently labelled (sfGFP) E. coli, auxotrophic for methionineDepositorBacterial ResistanceNoneAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TK310
Bacterial Strain#196340PurposeBacterial strain lacking adenlyate cyclase (cyaA, needed for cAMP synthesis) and phosphodiesterase (cpdA, which degrades cAMP); unable to control its intracellular cAMP levelsDepositorBacterial ResistanceNoneAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
XA106+pRCPam
Bacterial Strain#195858PurposeE. coli nonsense suppressor strain (leuX) transformed with plasmid carrying chromogenic protein (CP) with amber nonsense mutation in chromophore. Grows magenta when CP is induced with rhamnose.DepositorBacterial ResistanceChloramphenicolSpeciesAcropora milleporaAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
XA92+pRCPam
Bacterial Strain#195855PurposeE. coli nonsense suppressor strain (glnX) transformed with plasmid carrying chromogenic protein (CP) with amber nonsense mutation in chromophore. Grows purple when CP is induced with rhamnose.DepositorBacterial ResistanceChloramphenicolSpeciesAcropora milleporaAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
BL21 Rosetta2 ΔrecBCD GamS
Bacterial Strain#176586PurposeE. coli BL21 strain (with recBCD genomic locus deleted) for making cell-free extracts for Linear DNA expression. Contains pRARE2 + pBADmod1-linker2-gamS plasmids.DepositorBacterial ResistanceChloramphenicol and AmpicillinAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
BL21 Rosetta2 GamS
Bacterial Strain#176584PurposeE. coli BL21 strain for making cell-free extracts for Linear DNA expression. Contains pRARE2 + pBADmod1-linker2-gamS plasmids.DepositorBacterial ResistanceChloramphenicol and AmpicillinAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
BL21 Rosetta2 ΔrecB GamS
Bacterial Strain#176585PurposeE. coli BL21 strain (with recB genomic locus deleted) for making cell-free extracts for Linear DNA expression. Contains pRARE2 + pBADmod1-linker2-gamS plasmids.DepositorBacterial ResistanceChloramphenicol and AmpicillinAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
RNase III-His
Bacterial Strain#196903PurposeRNase III-His is an E. coli strain made for a cell-free expression system.DepositorBacterial ResistanceKanamycinAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only