We narrowed to 13,472 results for: sequence
-
Plasmid#47792PurposeExpresses enzymatically monobiotinylated full-length EBL1 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised EBL1
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONRG_P4-P1R:MUM4_0.3Pro_35S
Plasmid#128558PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing a 307 bp MUM4 (At1g53500) promoter fragment fused to the 54 bp 35S minimal promoter sequence, for use in Three-way Gateway cloningDepositorTypeEmpty backboneUseGateway promoter entry clonePromoterMUM4 core promoter with 35S enhancerAvailable SinceSept. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
FR_HNF4A2-C106R
Plasmid#31123DepositorInsertHNF4A (HNF4A Human)
TagsMycExpressionMammalianMutationsplice variant 2, mutation C106R. Wild type seq…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-LAP-KNL1-M3
Plasmid#115896PurposeUsed for expression of siRNA-resistant KNL1-M3 (modified codons 258 and 259) from the FRT site of FlpIn cells upon addition of doxycyclin.DepositorInsertKNL1-M3 (KNL1 Human)
TagsEYFPExpressionMammalianMutationFragment of KNL1 containing three KNL1 repeat seq…Available SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-H1-shRNA-CMV-HA-PACSIN1
Plasmid#72577PurposeBicistronic construct expressing PACSIN1 shRNA and HA-PACSIN1-rescue constructDepositorInsertsUseRNAiTagsHAExpressionMammalianMutation5 silent mutations around shRNA recognition seque…PromoterCMV and H1Available SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-AS9 (Mito MTS)-Delta N67-mMCL1
Plasmid#45822DepositorInsertAS9(Mito MTS)-Delta N67-mMCL1
ExpressionMammalianMutationATP Synthase subunit 9 is used as a Mito Targetin…Available SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRepair-SYFP2-CTNNB1
Plasmid#153432PurposeHomology Directed Repair construct for N-terminal tagging of hsCTNNB1 with SYFP2DepositorInsertCTNNB1 homology arms and SYFP2 coding sequence (CTNNB1 Human)
UseCRISPR; Hdr donor templateTagsSYFP2Available SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-Rosa26 gRNA (SpyCas9 scaffold)
Plasmid#120296PurposeAAV vector; encodes GFP as well as a U6-driven Rosa26-targeting gRNA (SpyCas9 scaffold)DepositorInsertRosa26 gRNA (SpCas9 scaffold)
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-AP-His
Plasmid#72049PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-MRPP3-His
Plasmid#67866Purposebacterial expression of PRORP (KIAA0391), full coding sequence (mitoch. form) + C-term. His tagDepositorInsertMRPP3 (KIAA0391 Human)
TagsHisExpressionBacterialMutationAmino acid 46 of recombinant MRPP3 is preceded by…PromoterT7Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC39A14
Plasmid#132105PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC39A14 (SLC39A14 Human)
ExpressionMammalianAvailable SinceDec. 3, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Nrp1-AP-His
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn3-AP-His
Plasmid#71941PurposeExpresses the extracellular region of the Contactin 3 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT-flk1-cytoBirA-2A-mCherry_Ras
Plasmid#80056PurposeFlk1/Kdrl promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterflk1Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC7A3
Plasmid#132301PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC7A3 (SLC7A3 Human)
ExpressionMammalianAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only