We narrowed to 12,297 results for: shRNA
-
Plasmid#111088PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human Lamin A/C gene.DepositorInsertLamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Rluc_miR
Plasmid#163332PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LMTK3 gRNA (BRDN0001145703)
Plasmid#77991Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMTK3 gRNA (BRDN0001148227)
Plasmid#77992Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BMX gRNA (BRDN0001146364)
Plasmid#75653Purpose3rd generation lentiviral gRNA plasmid targeting human BMXDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#1/Cre
Plasmid#173643PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1
Plasmid#175176PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting GrprDepositorInsertsgRNA-Grpr
UseAAV and CRISPRAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001149371)
Plasmid#75753Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LATS1 gRNA (BRDN0001146581)
Plasmid#76024Purpose3rd generation lentiviral gRNA plasmid targeting human LATS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LATS1 gRNA (BRDN0001146897)
Plasmid#76025Purpose3rd generation lentiviral gRNA plasmid targeting human LATS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAMKK2 gRNA (BRDN0001145732)
Plasmid#76696Purpose3rd generation lentiviral gRNA plasmid targeting human CAMKK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME2 gRNA (BRDN0001146233)
Plasmid#77933Purpose3rd generation lentiviral gRNA plasmid targeting human NME2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TGFBR2 gRNA (BRDN0001146812)
Plasmid#77468Purpose3rd generation lentiviral gRNA plasmid targeting human TGFBR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK1B gRNA (BRDN0001149482)
Plasmid#76623Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK1B gRNA (BRDN0001149418)
Plasmid#76621Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1BDepositorAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK4
Plasmid#138691PurposeExpresses a human MARK4-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
NEK2 gRNA (BRDN0001146193)
Plasmid#76214Purpose3rd generation lentiviral gRNA plasmid targeting human NEK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Rluc_miR
Plasmid#163333PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only