We narrowed to 25,345 results for: spr
-
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8ā¦PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA090
Plasmid#216099PurposeKnockout, EF1a-driven Cas12a (Cas only)DepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Consensus
Plasmid#176664PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUb dRxCas13d + RxCas13d guide RNA
Plasmid#176304PurposeExpresses catalytic dead RxCas13d and its associated guide RNA in Drosophila cellsDepositorInsertRxCas13d
TagsHA tagExpressionInsectMutationR239A, H244A, R858A, H863APromoterUbi-p63eAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1223
Plasmid#119261Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1221
Plasmid#119260Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_774
Plasmid#176659PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Agam_695
Plasmid#176654PurposeExpression of sgRNA under An. gambiae U6-2 (AGAP013695) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1335
Plasmid#119269Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJG85
Plasmid#89281PurposeEntry vector containing the TaU6 promoter and an Esp3I Golden Gate cloning site for cloning of the sgRNA, all between attL5 and attL2 sitesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
p944-SWITCH-OVER insert: EF1a-Puro
Plasmid#217891Purposeinsert vector for Switch-OVER: Single loxP-STOP-EF1a-Puro-mU6DepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP1363
Plasmid#119279Purposefor stabilizing ICE in the presence of rapI expressionDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBsVchCAST
Plasmid#203812PurposeExpression of CRISPR-associated transposases, shuttle vector for Bacillus subtilis / E. coliDepositorInsertVchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC
UseCRISPRExpressionBacterialAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262m3
Plasmid#149556PurposeGateway entry clone for CRISPR-iSpyMacCas9 ABE7.10 A-G base editing at NAAR PAMsDepositorInsertecTadAwt-ecTadAmut-ziSpyMacCas9(D10A)
UseCRISPRExpressionPlantMutationD10A, R221K, N394K, Protospacer interacting domaiā¦Available SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSHS306 - Bacterial expression plasmid for SpCas9, HNH FRET variant
Plasmid#87350PurposeS867C/S355C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-1 FRET constructDepositorInsertCas9
TagsHis-MBPExpressionBacterialMutationC80S/S355C/C574S/S867CPromoterT7Available SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP1104
Plasmid#119248Purposeknockdown pqsC in P. aeruginosaDepositorInsertsgRNA pqsC (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only