We narrowed to 462 results for: Pef1;
-
Plasmid#176459PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting EMX1 driven by EF1alpha promoter and and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-EMX1 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176460PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting HEK3 site driven by EF1alpha promoter and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-HEK3 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV5)
Viral Prep#87306-AAV5PurposeReady-to-use AAV5 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV1)
Viral Prep#87306-AAV1PurposeReady-to-use AAV1 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV9)
Viral Prep#87306-AAV9PurposeReady-to-use AAV9 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV2)
Viral Prep#87306-AAV2PurposeReady-to-use AAV2 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV pEF1a-DIO-FLPo-WPRE-hGHpA (AAV Retrograde)
Viral Prep#87306-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
PAM10
Plasmid#198743PurposepEF1-GFP, Geneticin resistanceDepositorInsertGFP
UseAcanthamoeba expressionPromoterpEF1Available SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
pEF‐PIK3IP1
Plasmid#49214Purposeexpresses PIK3IP1 in mammalian cellsDepositorAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
Integrin alpha5-AHCys
Plasmid#27313DepositorAvailable SinceMarch 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
Integrin alpha5(1-623)-AHCys
Plasmid#27301DepositorInsertintegrin alpha 5 (ITGA5 Human)
ExpressionMammalianMutationalpha 5(1-623)+GG+TEV+GGEN+AHCysAvailable SinceMarch 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pEF‐PIK3IP1
Plasmid#49214Purposeexpresses PIK3IP1 in mammalian cellsDepositorAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEF-APEX2-NLS
Plasmid#140281PurposeExpression of APEX2-NLSDepositorInsertAPEX2-NLS
ExpressionMammalianPromoterEF1aAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Integrin alpha5-AHCys
Plasmid#27313DepositorAvailable SinceMarch 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
PM PKA Reporter
Plasmid#104551PurposeExpresses Lyn-mTurquoise2-VASP at the plasma membrane of mammalian cellsDepositorInsertLyn-mTurquoise2-VASP 148 - 164
TagsmTurquoise 2, HA tagExpressionMammalianPromoterEF1 alphaAvailable SinceMarch 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
Integrin alpha5(1-623)-AHCys
Plasmid#27301DepositorInsertintegrin alpha 5 (ITGA5 Human)
ExpressionMammalianMutationalpha 5(1-623)+GG+TEV+GGEN+AHCysAvailable SinceMarch 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
OMM PKA Reporter
Plasmid#104550PurposeExpresses Tom20-mTurquoise2-VASP at the outer mitochondrial membrane of mammalian cells.DepositorInsertTom20 - mTurquoise2 - VASP 148-164
TagsmTurqouise2ExpressionMammalianPromoterEF1 alphaAvailable SinceMarch 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_all-in-one
Plasmid#183695PurposeExpresses CRISPRa components including dCas9-VP64, Synergistic Activation Mediators (SAM), mCherry, and gRNA expression cassette, blasticidin selectiveDepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_all-in-one_Bip gRNA1
Plasmid#183696PurposeExpresses gRNA targeting chinise hamster Bip (Hspa5) with CRISPRa components and mCherry, blasticidin selectiveDepositorInsertgRNA targeting chinese hamster Bip (Hspa5)
UseCRISPRAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD2604
Plasmid#175088PurposeMammalian expression of KSHV Orf 50 RTA phosphomutant generated by amino acid substitutions T604A introduced to WT RTA sequence from Nakamura et al., JVI 2003. 77:4205-20 (PMID: 12634378).DepositorInsertKSHV RTA phospho-mutant (ORF50) (ORF50 Kaposi's sarcoma-associated herpesvirus 8)
ExpressionMammalianMutationS644AAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD2601
Plasmid#175085PurposeMammalian expression of KSHV Orf 50 RTA phosphomutant generated by amino acid substitutions S47A, S65A, T75A introduced to WT RTA sequence from Nakamura et al., JVI 2003. 77:4205-20 (PMID: 12634378).DepositorInsertKSHV RTA phospho-mutant (ORF50) (ORF50 Kaposi's sarcoma-associated herpesvirus 8)
ExpressionMammalianMutationS47A, S65A, T75AAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD2602
Plasmid#175086PurposeMammalian expression of KSHV Orf 50 RTA phosphomutant generated by amino acid substitutions T424A, T438A introduced to WT RTA sequence from Nakamura et al., JVI 2003. 77:4205-20 (PMID: 12634378).DepositorInsertKSHV RTA phospho-mutant (ORF50) (ORF50 Kaposi's sarcoma-associated herpesvirus 8)
ExpressionMammalianMutationT424A, T438AAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDD2603
Plasmid#175087PurposeMammalian expression of KSHV Orf 50 RTA phosphomutant generated by amino acid substitutions T504A, T508A introduced to WT RTA sequence from Nakamura et al., JVI 2003. 77:4205-20 (PMID: 12634378).DepositorInsertKSHV RTA phospho-mutant (ORF50) (ORF50 Kaposi's sarcoma-associated herpesvirus 8)
ExpressionMammalianMutationT504A, T508AAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHPHS800
Plasmid#228240PurposeBxb1 attB_wildtype site and SpCas9-hygro for integration into Bxb1 attP_wildtype landing pad (eg. pHPHS232). Includes pEF1 and attP_GA for second round of recombinationDepositorInsertCas9
TagsHygromycin phosphotransferaseExpressionMammalianPromoternoneAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
vYM133_PB-pEF-osTIR1-T2A-iaaH-T2A-mGFPmut3-mAID-iCasp9-T2A-mCh-AID-BlastR
Plasmid#160046PurposeFor expressing the full paradoxical circuitDepositorInsertsosTIR1
iaaH
iCasp9
BlastR
UseSynthetic BiologyTagsmAID, mCherry, and mGFPmut3ExpressionMammalianPromoterno promoter, T2A is used and pEF1sAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
JPF0535a
Plasmid#124042PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing spdCas9 fused to tagBFP P2A tagBFP, and an sgRNA targeting pTRE expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-spdCAS9::tagBFP-P2A-tagBFP-SV40PA_mu6-sgTRE_pTRE-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB365
Plasmid#124048PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to mRuby2 P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::mRuby2-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB366
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB367
Plasmid#124050PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJW1511
Plasmid#62365PurposepEF1a-puro-T2A-ATHmmuRPL10ADepositorInsertPuro-T2A-AVITEVHAmmuRPL10A
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
FH-TET3-pEF
Plasmid#49446PurposeThis plasmid expresses full-length human TET3.DepositorInsertTet methylcytosine dioxygenase 3 (TET3 Human)
TagsFlag and HAExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNK7189
Plasmid#219759PurposeVector for expression At4CL2 in mammalian cells (HEK293NT)DepositorInsertAt4CL2
ExpressionMammalianPromoterpEF1Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FH-TET1-pEF
Plasmid#49792PurposeThis plasmid expresses the full-length human TET1 gene with a Flag and HA tag.DepositorInsertTet methylcytosine dioxygenase 1 (TET1 Human)
TagsFlag and HAExpressionMammalianPromoterEF-1alphaAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
FH-Tet2-pEF
Plasmid#41710PurposeThis plasmid expresses mouse Tet2 with N-terminal FLAG and HA tags in a mammalian systemDepositorInserttet methylcytosine dioxygenase 2 (Tet2 Mouse)
TagsFLAG and HAExpressionMammalianPromoterEF1aAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
MTK2_007
Plasmid#123702PurposeEncodes human pEF1alpha as a Type 2 part to be used in the MTK systemDepositorInsertpEF1a
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
JPF0510
Plasmid#124001PurposeEncodes pEF1a driving expression of mAzamiGreen with an mScarlet normalization in a PiggyBac destination vectorDepositorInsertPB_pEF1a-NLS-mAzamiGreen-bghpA_pCAG-H2B::mScarlet-rglpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ipYUC2Cas-LT1
Plasmid#210559PurposeBinary vector expressing the estradiol-inducible Lineage Tracing system. XVE expression driven by M. polymorpha YUC2 promoter.DepositorInsertpMpEF1::XVE::UBQ10t::LexA::SpCas9::PEA3AT::pU6::AAVS1gRNA::pMpEF1::LT1::Hygromycin
ExpressionPlantAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK2_025
Plasmid#123717PurposeEncodes crippled human pEF1alpha as a Type 2 part to be used in the MTK systemDepositorInsertpEF1ac
ExpressionMammalianMutationCrippled Kozac sequenceAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
JPF0522
Plasmid#124013PurposeEncodes crippled pEF1a driving expression of mAzamiGreen with an mScarlet normalization in a PiggyBac destination vectorDepositorInsertPB_pEF1ac-NLS-mAzamiGreen-bghpA_pCAG-H2B::mScarlet-rglpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB287d
Plasmid#124018PurposeEncodes pEF1a driving expression of mAzamiGreen with a spacer 3' UTR and a mScarlet normalization in a PiggyBac destination vectorDepositorInsertPB_pEF1a-NLS-mAzamiGreen-spacer_pCAG-H2B::mScarlet-rglpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB287e
Plasmid#124019PurposeEncodes pEF1a driving expression of mAzamiGreen with a multicistronic spacer 3' UTR and a mScarlet normalization in a PiggyBac destination vectorDepositorInsertPB_pEF1a-NLS-mAzamiGreen-spacermulticistronic_pCAG-H2B::mScarlet-rglpA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only