We narrowed to 465 results for: Cyanobacteria
-
Plasmid#165581PurposeLon protease from Mesoplasma florumDepositorInsertlon protease
ExpressionBacterialPromoterPtrcAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ155
Plasmid#175054PurposepsbEFLJ integrative plasmid expresses CRE recombinase from the rbcL promoter uses zeocin to integrateDepositorInsertCRE
UseUnspecifiedPromoterrbcLXSAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KaiC
Plasmid#41884DepositorInsertKai C
TagshistadineExpressionBacterialPromotert7Available SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
KaiB-FLAG
Plasmid#41885DepositorInsertKai B
TagsFLAGExpressionBacterialPromotert7 promoterAvailable SinceMarch 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRL528
Plasmid#58495Purposehelper plasmid for bacterial conjugal DNA transferDepositorInsertencodes methylases AvaiM and Eco47iiM that target sites subject to restriction in Anabaena sp. strain PCC 7120
Available SinceOct. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAM4941 (pCV0053)
Plasmid#120083PurposeCyanobacteria cloning vector. Chromosomal integration into Synechococcus elongatus neutral site 3 (NS3).DepositorInsertPlasmid assembled from 3 CYANO-VECTOR modular devices: CV-S7942NS3-RK2BOM, CV-aacC1, CV-ccdB-SwaI
UseOtherAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM4937 (pCV0049)
Plasmid#120082PurposeCyanobacteria cloning vector. Chromosomal integration into Synechococcus elongatus neutral site 2 (NS2).DepositorInsertPlasmid assembled from 3 CYANO-VECTOR modular devices: CV-S7942NS2, CV-aph1, CV-ccdB-SwaI
UseOtherAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCK314
Plasmid#110545PurposeModified (delta CRP-binding site) rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteriaDepositorInsertsModified PrhaBAD (CRP-binding sites removed)
yfp
rhaS
ExpressionBacterialAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM4951 (pCV0063)
Plasmid#120084PurposeCyanobacteria cloning vector. Chromosomal integration into Synechococcus elongatus neutral site 1 (NS1).DepositorInsertPlasmid assembled from 3 CYANO-VECTOR modular devices: CV-S7942NS1-RK2BOM, CV-aadA_nt, CV-ccdB-SwaI.
Available SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM5057
Plasmid#120085PurposeBroad host range plasmid. Theophylline inducible expression of YFP in various cyanobacteria.DepositorInsertRSF1010 Y25F aadA PconII theophylline riboswitch F with myc-yfp reporter
UseOtherAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-slr0230-PL22-sgRNANT1-KmR
Plasmid#73224PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coliDepositorInsertPL22-sgRNA NT1
ExpressionBacterialPromoterPL22Available SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSHDY-Prha-mVenus_rhaS
Plasmid#137662PurposeConjugative vector derived from pSHDY. Constitutive expression of the activator rhaS, as well as rhamnose-inducible expression of mVenus.DepositorInsertPrha:mVenus
ExpressionBacterialMutationrhaS (Arg218Leu)PromoterPrhaAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSHDY-PvanCC-mVenus_vanR
Plasmid#137664PurposeConjugative vector derived from pSHDY. Constitutive expression of the repressor vanR, as well as vanillate-inducible expression of mVenus.DepositorInsertPvanCC:mVenus
ExpressionBacterialPromoterPvanCCAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSHDY-PL03-mVenus_tetR
Plasmid#137663PurposeConjugative vector derived from pSHDY. Constitutive expression of the repressor tetR, as well as aTc-inducible expression of mVenus.DepositorInsertPL03:mVenus
ExpressionBacterialPromoterPL03Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCcmO-StrepII-PDT
Plasmid#165584PurposeNative CcmO fusion with a StrepII tag and PDTDepositorInsertCcmO-PDT
TagsProtein degradation tagExpressionBacterialAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPO640
Plasmid#195296PurposepTA106-Myacmini-KanR, donor plasmid with mini-transposon of McCAST (Tn7575).DepositorInsertminiMcCAST (Tn7575) with KanR
ExpressionBacterialAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-slr0230-PL31-sgRNANT1-KmR
Plasmid#73221PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coliDepositorInsertPL31-sgRNA NT1
ExpressionBacterialPromoterPL31Available SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
CpcB•PHLS+Cpc
Plasmid#73335PurposeExpresses the PHLS gene as a fusion with the CpcB gene followed by the CmR geneDepositorInsertcpcB•PHLS-CmR
Promotercpc operonAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL2680
Plasmid#85581PurposeReplicating base vector for constructing cpf1/CRISPR editing plasmidsDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only