We narrowed to 301 results for: myc p35
-
Plasmid#15602DepositorInsertSup35 NM (SUP35 Budding Yeast, Candida albicans)
UseTags7xHis and CysteineExpressionBacterialMutation4 G/A. Four glycines mutated to alanines. The pos…PromoterAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha2 P35S:RDF:T35S (GB1508)
Plasmid#160613PurposeTU for the constitutive expression of Streptomyces phage PhiC31-encoded recombination directionality factor (RDF) (PhiC31 gp3)DepositorInsertRDF
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoter35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
L0-T15 BpiI-p35s-BpiI
Plasmid#219698PurposeLevel 0 to insert p35S promoter to history-dependent targetDepositorInsertBpiI-p35s-BpiI
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 P35S:BFP:T35S (GB3416)
Plasmid#160637PurposeTU for the constitutive expression of Blue Fluorescent ProteinDepositorInsertBFP
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoter35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB2_alpha2 P35S:CUP2:GAL4AD:T35S (GB1039)
Plasmid#160607PurposeTU for the constitutive expression of the transcriptional activator protein CUP2 in C-terminal fusion with GAL4 activation domain (GAL4AD). Binds to specific DNA operator in the presence of copper ions and promotes transcription.DepositorInsertCUP2Gal4AD
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
R777-E012 Hs.ARHGAP35-nostop
Plasmid#70296PurposeGateway ORF clone of human ARHGAP35 [NM_004491.4] without stop codon (for C-terminal fusions)DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S::SP-mCherry-GFP-HDEL
Plasmid#159097PurposePositive control for FRET in plant ER / nuclear envelope.DepositorInsertSP-mCherry-GFP-HDEL
UseTagsmCherry, GFPExpressionPlantMutationPromoter35SAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 P35S:LbCas12a:T35S (GB1441)
Plasmid#160611PurposeTranscriptional unit for the expression of the LbCas12a in plant systems driven by the CaMV35s promoter.DepositorInsertP35s:LbCas12a:T35s
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 P35S:AsCas12a:T35S (GB1440)
Plasmid#160610PurposeTranscriptional unit for the expression of the AsCas12a in plant systems driven by the CaMV35s promoter.DepositorInsertP35s:AsCas12a:T35s
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha1 P35S:SV40-AcrIIA4_CONb:Tnos (GB3344)
Plasmid#160635PurposeTU for SV40-AcrIIA4 protein Codon optimized for N. benthamiana expression under the regulation of the 35S promoter and Tnos terminatorDepositorInsertAcrIIA4
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoter35SAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sup35 Sc/Ca NM Chimera S17R His7 Cys
Plasmid#15601DepositorInsertSup35 NM (SUP35 Budding Yeast, Candida albicans)
UseTags7xHis and CysteineExpressionBacterialMutationS17R. Serine 17 mutated to arginine.PromoterAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
p35S::mCh-HA-P2A-lifeact-mCh
Plasmid#135234Purposeconstitutive expression of 2 mCherry molecules: one tagged with HA and another that binds to actin (control plasmid)DepositorInsertmCh-HA-P2A-lifeact-mCh
UseTagsHA, lifeact, and p2aExpressionPlantMutationPromoter35SAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup35-EcoRI
Plasmid#87332PurposeTo express shRNA against human Nup35DepositorInsertshRNA against human Nup35
UseRNAiTagsExpressionMammalianMutationPromoterH1Available SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
stabilized HP35 tension sensor module
Plasmid#101251PurposeExpresses the stabilized HP35-based tension sensor module. The biosensor allows force measurements at 9-11 pN.DepositorInsertYPet(short)-HP35st-mCherry
UseRetroviralTagsHis-tag and cysteineExpressionMammalianMutationPromoterCMVAvailable SinceNov. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:SRDX:Tnos (GB1188)
Plasmid#160608PurposeTU for the expression of the dCas9 with the repressor domain SRDX as a CT fusion (CRISPR tools)DepositorInsertP35s:dCas9:SRDX:tNOS
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830)
Plasmid#160624PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain VPR (VP64+p65+Rta)DepositorInsertP35S:MS2:VPR:Tnos
UseTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:TV:Tnos (GB2048)
Plasmid#160627PurposeTU for the constitutive expression of Ms2 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-MS2:TV-Tnos
UseTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:EDLL:Tnos (GB1738)
Plasmid#160622PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain EDLLDepositorInsertP35s_MS2:EDLL_Tnos
UseTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:TV:Tnos (GB2047)
Plasmid#160626PurposeTU for the constitutive expression of dCas9 fused to TV (TALx6 - VP128) activation domainsDepositorInsertP35s-dCas9:TV-Tnos
UseTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only