We narrowed to 7,360 results for: ust
-
Viral Prep#179459-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE (#179459). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE plasmid DNA. EF1a-driven, Cre-dependent soma and AIS-localized expression of voltage indicator JEDI-2P. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagscEGFP (Cre-dependent)Available SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only
-
hSyn-DIO-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154951-AAVrgPurposeReady-to-use AAV Retrograde particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Toronto KnockOut version 3 library (TKOv3)
Pooled Library#90294PurposeOptimized library offering improved accuracy, efficiency, and scalability for CRISPR screens compared to TKOv1DepositorAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
microTRE Screening Library
Pooled Library#1000000220DepositorAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available SinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
LibTest
Pooled Library#113147PurposeCustomized sgRNA library targeting 86 E. coli genesDepositorExpressionBacterialAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-MPRA_minCMV Library
Pooled Library#201012PurposeMassively parallel reporter assay (MPRA) library with minCMV promoterDepositorExpressionMammalianUseLuciferaseAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-MPRA_minPromega Library
Pooled Library#201013PurposeMassively parallel reporter assay (MPRA) library with minPromega promoterDepositorExpressionMammalianUseLuciferaseAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-MPRA_minTK Library
Pooled Library#201014PurposeMassively parallel reporter assay (MPRA) library with minTK promoterDepositorExpressionMammalianUseLuciferaseAvailable SinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMetTU1-A_Sv5K_araC-PBAD_MCD1_MegaB-S9G-R31L-R85L_MegaRNFGLSKJTU_Bba-B0015
Plasmid#202025PurposeExpresses Bacillus megaterium ARG cluster (GvpB S9G-R31L-R85L mutant) in E. coliDepositorInsertBacillus megaterium ARG cluster (GvpB S9G-R31L-R85L mutant)
ExpressionBacterialMutationGvpB S9G-R31L-R85LAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMetTU1-A_Sv5K_araC-PBAD_MCD1_AnaA-T6A-I48V_AnaCNJKFGW_Bba-B0015
Plasmid#202023PurposeExpresses Anabaena flos-aquae ARG cluster (GvpA T6A-I48V mutant) in E. coliDepositorInsertAnabaena flos-aquae ARG cluster (GvpA T6A-I48V mutant)
ExpressionBacterialMutationGvpA T6A-I48VAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMetTU1-A_Sv5K_araC-PBAD_MCD1_AnaA-T6A-L40A_AnaCNJKFGW_Bba-B0015
Plasmid#202024PurposeExpresses Anabaena flos-aquae ARG cluster (GvpA T6A-L40A mutant) in E. coliDepositorInsertAnabaena flos-aquae ARG cluster (GvpA T6A-L40A mutant)
ExpressionBacterialMutationGvpA T6A-L40AAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a-T5-ASG_ClpXP
Plasmid#153299PurposeExpresses acoustic sensor genes or ClpXP-sensitive gas vesicles in E. coli Nissle 1917DepositorInsertASG
UseSynthetic BiologyExpressionBacterialPromoterT5Available SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
KaiB
Plasmid#42496DepositorInsertKai B
ExpressionBacterialPromotert7Available SinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only