We narrowed to 1,763 results for: MS2;
-
Plasmid#171932Purposeexpress MS2 coat protein (MCP) fused to superfolder GFP and histone subunit H2B fused to mCherry in an operonDepositorInsertPmex-5::MS2 Coat Protein::linker::sfGFP::tbb-2 3'UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3'UTR
Tagssuperfolder GFP, mCherryExpressionWormPromoter-Available SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTK332
Plasmid#59573PurposeSIN SP6 P1234 (nsP2 P726S) SGP(14) 2xK-turn Kozak MS2-CNOT7 (SacI mutated)-P2A-EBFP2-4xFF5DepositorInsertSGP(14) 2xK-turn Kozak MS2-CNOT7 (SacI mutated)-P2A-EBFP2-4xFF5
Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
dCas13d-dsRBD-APEX2
Plasmid#154939PurposeTetON-APEX2-V5-BPNLS-dRfxCas13d-dsRBD-BPNLS-P2A-GFPDepositorInsertTetON-APEX2-V5-BPNLS-dRfxCas13d-dsRBD-BPNLS-P2A-GFP
TagsV5ExpressionMammalianPromoterTRE3GAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-tdMCP-tdTomato
Plasmid#183938Purposetandem MS2 binding protein labeled with tdTomato, containing a NLS and a HA-tagDepositorInserttdMCP-tdTomato (cp Synthetic)
TagsNLS-HAExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC545
Plasmid#62313PurposesgRNA with 1x MS2 for yeast cellsDepositorInsertsgRNA + 1x MS2 binding module
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC583
Plasmid#62314PurposesgRNA with 2x MS2 for yeast cellsDepositorInsertsgRNA + 2x MS2 binding module
ExpressionYeastPromoterSNR52Available SinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC593
Plasmid#62319PurposesgRNA with MS2-PP7 for yeast cellsDepositorInsertsgRNA + MS2-PP7 RNA binding module
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8.3
Plasmid#121959PurposeMammalian expression, Transcription regulation, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, MS2 hairpin inserted
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSK450
Plasmid#34552DepositorInsertMS2-CP-NLS
TagsmCherryExpressionYeastPromoterMet25Available SinceJan. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-Ezh2
Plasmid#126590PurposeExpresses MCP (MS2 Coat Protein) fusion to Ezh2 in mammalian cells, lentiviral backboneDepositorInsert2XMCP-Ezh2 (Ezh2 Synthetic, Mouse)
UseLentiviralTagsNLS-HAExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR SFFVp MCP-mCherry IRES h2b-diRFP
Plasmid#102351PurposeLentiral expression vector bearing the MS2 Coat Protein (MCP) fused to mCherry as well as the nuclear marker histone 2b fused to two copies of irFP. Also bears the hygromycin selection marker.DepositorInsertMS2 Coat Protein
UseLentiviralTagsmCherryPromoterSFFVAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD442
Plasmid#153024PurposedCas9, MCP-SoxS(R93A/S101A)DepositorInsertdCas9, MCP-SoxS(R93A/S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsAvailable SinceAug. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ173
Plasmid#99907PurposeExpress CRISPR-Act2.0 system which contains pco-dCas9-VP64 fusion protein and MS2-VP64 fusion protein linked by in-frame T2A (encoding Thosea asigna 'self-cleaving' 2A peptide) sequenceDepositorInsertpco-dCas9-VP64-T2A-MS2-VP64
UseCRISPRExpressionPlantAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
EK0409 SFFV-mCherry-SGc(s70587)cSG-EGFP (FLP-IN)
Plasmid#191164PurposeSimilar to EK0285 but has additional restriction sites around the sensor sequence. Recommended for cloning new sensors when the presence of MS2 sequences are not relevant (use EK0438 if MS2 sequencesDepositorInsertmCherry:s70587:EGFP (additional cutsites)
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
NLS-HA-2xMCP-KRAB
Plasmid#126589PurposeExpresses MCP (MS2 Coat Protein) fusion to KRAB in mammalian cells, lentiviral backboneDepositorInsert2XMCP-KRAB
UseLentiviralTagsNLS-HAExpressionMammalianPromoterhuman ubiquitin C promoterAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCD564
Plasmid#153026PurposedxCas9(3.7), MCP-SoxS(R93A/S101A)DepositorInsertdxCas9(3.7), MCP-SoxS(R93A/S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsAvailable SinceAug. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYJ15-PB-U6-Nkx6.1-acti-gRNA1
Plasmid#131059PurposeActivation of NKX6.1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ16-PB-U6-Nkx6.1-acti-gRNA2
Plasmid#131060PurposeActivation of NKX6.1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only