We narrowed to 16,291 results for: grna
-
Plasmid#218652PurposeKnockout vector for mouse Hook2DepositorAvailable SinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only
-
msHook2 g2 lentiCRISPRv2-mCherry
Plasmid#218653PurposeKnockout vector for mouse Hook2DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh2-2300
Plasmid#170984PurposeEncodes sgRNA target 2300 and Kanamycin resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh3-2300
Plasmid#170985PurposeEncodes sgRNA target 2300 and Tetracycline resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh8-2300
Plasmid#170986PurposeEncodes sgRNA target 2300 and Hygromycin resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-gR085
Plasmid#188554PurposeBinary vector for CRISPR/Cas9 targeted to MpIGPD in Marchantia polymorpha (for Agrobacterium-mediated genetic transformation)DepositorInsertgR085
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR082
Plasmid#188551PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR082
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR085
Plasmid#188552PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR085
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 sgZER1-1
Plasmid#191549PurposeExpression of spCas9 and sgRNA targetting ZER1DepositorInsertspCas9 (ZER1 Human)
UseLentiviralAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 sgZER1-2
Plasmid#191550PurposeExpression of spCas9 and sgRNA targetting ZER1DepositorInsertspCas9 (ZER1 Human)
UseLentiviralAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP2132
Plasmid#160075PurposeZ. mobilis CRISPRi, promoter B, empty guideDepositorInsertempty sgRNA
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAS1sg
Plasmid#154341PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAS1 sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAS2sg
Plasmid#154342PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAS2 sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CANTsg
Plasmid#154343PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCANT sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAPsg
Plasmid#154344PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAP sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYZ292
Plasmid#102686PurposeS. pombe gRNA entry vector with Cas9 - ScLEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSuper-PlexinB2
Plasmid#115175PurposeshRNA against rodent PlexinB2DepositorInsertshRNA targeting Plxnb2
UseRNAiAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC132.1-spp-9
Plasmid#26503DepositorInsertspp-9
UseRNAiAvailable SinceFeb. 16, 2011AvailabilityAcademic Institutions and Nonprofits only