We narrowed to 14,264 results for: crispr grnas
-
Plasmid#99892PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ135B2.0
Plasmid#167159PurposeGolden Gate entry vector to express the 5th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136B2.0
Plasmid#167160PurposeGolden Gate entry vector to express the 6th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT040
Plasmid#67640PurposeURA3 vector for cloning guide sequences using BclI-SwaI sites into guide RNA expression cassetteDepositorInsertsingle guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-crRNA
Plasmid#213753PurposeFor circular RNA-mediated prime editor using LbCas12a-crRNA in HEK293T cellsDepositorInsertLbCas12a-crRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBEC6
Plasmid#187598PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Gentamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-BFP-backbone
Plasmid#85707PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with a BFP fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-LwaCas13acrRNA-BsmBIcassette (LTH151)
Plasmid#171129PurposeLwaCas13a crRNA entry vector for pU6 expression (need to clone in spacer into BsmBI sites)DepositorInsertU6 promoter entry plasmid for LwaCas13a crRNA cloning
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMBEC2
Plasmid#187596PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Kanamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi-tRNA
Plasmid#158578PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 and pYPQ132-tRNA2.0; assembly of 2 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ143-ZmUbi-tRNA
Plasmid#158400PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ133-tRNA2.0; assembly of 3 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pREDIT_Cas9n-MS2-BB_BbsI
Plasmid#164804PurposeREDIT backbone for nickase Cas9n, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9n(D10A)-T2A-EGFPDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ145-ZmUbi-tRNA
Plasmid#158403PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ135-tRNA2.0; assembly of 5 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVG1
Plasmid#111444PurposeUnified Solo vector pV1382 + sgScADE2 + ScADE2 stop codon repair tempateDepositorInsertCaCas9/sgScADE2/stop-codon repair
UseCRISPRExpressionYeastAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMBEC8
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133C2.0
Plasmid#99893PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only