We narrowed to 13,850 results for: sequence
-
Plasmid#72030PurposeExpresses the extracellular region of the Sema4C protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MO91-ORAI1N223A-TEV-pHluorin (ORAI1-EC-pHluorin)
Plasmid#174336PurposeThe ORAI1N223A mutant containing-TEV-pHluorin-TEV sequence in the extracellular loop 2DepositorInserthuman Orai1 (ORAI1 Human)
UseRetroviralTagspHluorin inserted in the extracellular loop 2 of …ExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-Fc-His
Plasmid#72147PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINT4
Plasmid#127530PurposePlasmid encodes A. thaliana codon optimized Integrase 4.DepositorInsertIntegrase 4 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pf92-bio
Plasmid#47728PurposeExpresses enzymatically monobiotinylated full-length Pf92 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised Pf92
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Flrt2-AP-His
Plasmid#71948PurposeExpresses the extracellular region of the FLRT2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-MRPP3-myc-His
Plasmid#67864Purposebacterial expression of PRORP (KIAA0391), full coding sequence (mitoch. form) + C-term. myc-His tagDepositorInsertMRPP3 (KIAA0391 Human)
TagsHis and mycExpressionBacterialMutationAmino acid 46 of recombinant MRPP3 is preceded by…PromoterT7Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
PET28-FnCas12a-EP16
Plasmid#183636PurposePET28-FnCas12a-EP16 can efficiently recognize a broad range of PAM sequences including YN (Y = C or T), TAC and CAA.DepositorInsertFnCas12a-EP16
UseCRISPRTags6×His TagExpressionBacterialMutationN607R, K613V, N617R, K180S, K660R, D616NAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-CCR5-VC
Plasmid#98966Purposemyc-tagged human CCR5 fused to C-terminus of split VenusDepositorInsertCCR5 (CCR5 Human)
TagsSignal/leader sequence from Influenza A virus HA …ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-FLIP pr4
Plasmid#19129DepositorInsertFLIP promoter (CFLAR Human)
UseLuciferaseExpressionMammalianMutationThe sequence corresponds to positions -503 to +10…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 Q1779Stop
Plasmid#139331PurposePlasmid expressing a sgRNA to introduce BRCA1 Q1779Stop using base editingDepositorInsertsgRNA to insert BRCA1 Q1779Stop using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HsNot1iso1_840-1605_X
Plasmid#147997PurposeMammalian Expression of HsNot1iso1_840-1605DepositorInsertHsNot1iso1_840-1605 (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation compared to the sequence of iso…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 T922I
Plasmid#139328PurposePlasmid expressing a sgRNA to introduce BRCA1 T922I using base editingDepositorInsertsgRNA to insert BRCA1 T922I using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9
Plasmid#126766PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9.DepositorInsertB-HeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; K848A; Q926A; K1003A; R1060A…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
mito-yHS1-M7A,H102A
Plasmid#159165PurposeMitochondrial labile heme reporterDepositorInsertmito-yHS1-M7A,H102A
TagsCOX4 pre-sequenceExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiGuideFB-Puro-B
Plasmid#192507PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInsertbU6-sgRNACR2-CS-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterbU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.TRC1.shmNsd1.2, puro
Plasmid#114447PurposeLentiviral vector for expression of shRNA sequence targeting mouse Nsd1DepositorInsertshNsd1.2 (Nsd1 Mouse)
UseLentiviral and RNAiAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Neo1.h-AP-His
Plasmid#71970PurposeExpresses the extracellular region of the Neogenin 1, isoform h protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only