We narrowed to 10,645 results for: ESP
-
Plasmid#184924PurposeLentiviral vector for expressing Ovalbumin. Also expresses the puromycin resistance gene as a selectable marker.DepositorInsertOvalbumin (OVAL Chicken)
UseLentiviralExpressionMammalianMutationOur vector has an A188T mutation that does not im…PromoterPGKAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-SRRM2-mCherry
Plasmid#174089PurposeInducibly expresses SRRM2-mCherry in mammalian cells with the Tet-on systemDepositorAvailable SinceSept. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244092PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(mem).iGlucoSnFR2.mRuby3
Plasmid#244097PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
Plasmid#234724PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in neurons. The plasmid lacks AAV2 ITR and f1 ori elements, enabling more efficient transfection and expression.DepositorTypeEmpty backboneUseCRISPRTagsT2A-GFPExpressionMammalianPromoterCAG promoterAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.1.t1
Plasmid#73547PurposetRNA synthetase/tRNA pair for the in vivo incorporation of p-azido-l-phenylalanine, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.1.t1
pAzFRS.1.t1
ExpressionBacterialAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.2.t1
Plasmid#73546PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.2.t1
pAzFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
XRE-H2B-eGFP
Plasmid#182294PurposeFluorescent reporter for AhR activityDepositorAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HRE-dUnaG
Plasmid#124372PurposeUnaG fluorescent protein reporter for hypoxia-induced factor (HIF) signalingDepositorInsertHRE-dUnaG
UseLentiviralTagsPEST-degron and Myc tagPromoterHRE (HIF responsive element 5x + CMV minimal prom…Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
NL4-3 mCherry Luciferase
Plasmid#44965PurposeHIV dual reporter vector expressing mCh & Luc to simultaneously measure the # of cells containing reactivated latent provirus and the overall strength of viral transcriptional response in these cells.DepositorInsertmCherry, Luciferase, IRES
UseLentiviralTagsLuciferase, IRES and mCherry with D212GMutationS34C mutation in NefAvailable SinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.2.t1
Plasmid#73544PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.2.t1
pAcFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244101PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1b-ST-WPRE
Plasmid#214967PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for brighter fluorescenceDepositorInsertCepheid1b-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Ace-mNeon2-Kv2.1PR
Plasmid#195528PurposeGreen fluorescent, negative response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertAce-mNeon2-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 81S; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1s-ST-WPRE
Plasmid#214968PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for better photostabilityDepositorInsertCepheid1s-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244072PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244099PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only