We narrowed to 32,967 results for: multi
-
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
TagsCas9-Venus fusion proteinExpressionMammalianPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
tol2-mpx-cxcr4b whim-gfp
Plasmid#41089DepositorInsertCXCR4b-WHIM (cxcr4b Zebrafish)
TagsGFPExpressionBacterialMutationdeleted last 19 amino acids of cxcr4bPromotermpxAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
piggyBac-rtTA (4th_Gen)-SNCA(A53T)-sfGFP-IRES-NGN2-puro (VK_1123)
Plasmid#209080PurposeNgn2 mediated cortical neuron induction, along with SNCA(A53T)-sfGFP over-expressionDepositorTagssfGFPExpressionMammalianMutationA53TPromoterTRE4GAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry
Plasmid#170185PurposeExpression vector for a sgRNA against BFP and spCas9-Ec86 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Ec86 msr-msd region by SpeI and AvrII.DepositorInsertsEc86 RT
Retron Ec86 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianPromoterCBh and hU6Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-WT-WLS-HA-IRES-GFP
Plasmid#178061PurposeExpression of WLS-HA protein (WT)DepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-CAT
Plasmid#173943PurposeBacterial expression of isolated PARP1 CAT domainDepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tol2-CAG::Mitbow
Plasmid#158994PurposeMulticolor mitochondrial-restricted labeling with a genome-integrating Tol2 transposon vector (randomly expressing mito-tethered mEYFP, mCherry or mCerulean upon Cre recombination)DepositorInsertMitbow
TagsThe default expressed EBFP2 is fused to H2B; oth…ExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GRET
Plasmid#158222PurposeControl lentiviral plasmid encoding GFP-Nluc BRET reporter from Schaub et al., Cancer Research, 2015.DepositorInsertGFP-Nluc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
TK-GFP-Nluc-P2A-neo-TK
Plasmid#134896PurposeExpresses GFP protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum TK locusDepositorInsertTK-GFP-Nluc-P2A-Neo-TK
UseCryptosporidium expressionPromoterCryptosporidium actin and enolaseAvailable SinceNov. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-I
Plasmid#53439PurposeT7-dependent expression of the type-I agrB and agrD genes of S. aureus RN4220DepositorInsertagrBD locus
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationnonePromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV40 L1L2
Plasmid#52593PurposeExpresses HPV40 L1 and L2 in mammalian cellsDepositorInsertsHPV40 L1
HPV40 L2
ExpressionMammalianAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV70 L1L2
Plasmid#52603PurposeExpresses HPV70 L1 and L2 in mammalian cellsDepositorInsertsHPV70 L1
HPV70 L2
ExpressionMammalianAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV44 L1L2
Plasmid#52597PurposeExpresses HPV44 L1 and L2 in mammalian cellsDepositorInsertsHPV44 L1
HPV44 L2
ExpressionMammalianAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO-HPV26 L1L2
Plasmid#52601PurposeExpresses HPV26 L1 and L2 in mammalian cellsDepositorInsertsHPV26 L1
HPV26 L2
ExpressionMammalianAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJFRC156-21XUAS-B2RT>-dSTOP-B2RT>-myr::RFP
Plasmid#32135DepositorInsertB2RT> STOP STOP B2RT>
ExpressionInsectAvailable SinceNov. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_Lifeact-HaloTag11-T2A-Tomm20-HaloTag7
Plasmid#175526PurposeCo-expression of HaloTag11 (actin) and 7 (mitochondrial surface) in mammalian cellsDepositorInsertLifeact-HaloTag11 and Tomm20-HaloTag7
ExpressionMammalianMutationHaloTag11 = HaloTag7-M175WAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTetR-LasR-pLuxR-GFP
Plasmid#171159PurposeSensing Device with Reporter proteinDepositorInsertslasR
gfp
UseSynthetic BiologyExpressionBacterialPromoterpLux and pTetAvailable SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTol2 hsp70l loxP-Non-FP-loxP-nCas9n-GFP
Plasmid#158963PurposeCre-dependet Cas9-GFP expressionDepositorInsertshsp70l promoter
floxed Non-FP cassette
Cas9-GFP
UseCRISPR and Cre/LoxAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only