We narrowed to 13,402 results for: crispr grnas
-
Plasmid#76327Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146936)
Plasmid#76328Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKSB-618 U6-sgRNA2/3 GGAA AACA
Plasmid#173674PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSB-631 U6-sgRNA3/4 AACA GCTT
Plasmid#173675PurposeTo clone and express a gRNA in AnophelesDepositorTypeEmpty backboneUseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PE-pegRNA(BG)-nsgRNA(BG)
Plasmid#232727PurposeA dual-targeting vector that contains PE3 system guide RNAs against BFP (pegRNA(BG) and nsgRNA(BG)) with restriction enzyme sites for insertion of target site guide RNAS (pegRNAs(TS) and nsgRNA(TS)).DepositorInsertpegRNA(BG), nsgRNA(BG), pegRNAs(TS), nsgRNA(TS)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBx-Spas-sgRNA-Kan
Plasmid#105233PurposePlasmid containing S. pasteurianus sgRNA with no 20bp target (Empty control) Kanamycin marker for P. putida and P. fluorescensDepositorInsertS. pasteurianus sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330GFP-hU6-gRNA-hSpCas9
Plasmid#128385PurposeGFP positive gRNA/hSpCas9 constructDepositorInsertGFP, gRNA and hSpCas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.clr-2.Y-SUP4t
Plasmid#89692PurposegRNA for clr-2 locusDepositorInsertgRNA for clr-2 locus
UseCRISPR; GrnaTagsNoExpressionMutationPromoterAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCF820_U6-sgRNA-EF1a-mCherry2_lenti
Plasmid#138316PurposeLenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFPDepositorInsertSpyCas9 GFP sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
1046E=dgRNAs[traB,bTub]
Plasmid#149425PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes.DepositorInsertU6.3-gRNAs[TraB, bTub]
UseCRISPRTagsExpressionInsectMutationPromoterU6.3Available sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330_Rosa_sgRNA
Plasmid#97007PurposeExpresses Cas9 and Rosa26 locus specific sgRNADepositorInsertRosa26 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available sinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
UseTagsExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-th-sgRNA
Plasmid#65565Purposein vitro trancription of sgRNA targeting the zebrafish th locusDepositorInsertth sgRNA (th Zebrafish)
UseIn vitro rna transcriptionTagsExpressionMutationPromoterT7Available sinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-2XPP7
Plasmid#75390PurposesgRNA1-2XPP7DepositorInsertsgRNA1-2XPP7
UseCRISPR and LentiviralTagsnoExpressionMammalianMutationPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRTagsExpressionMammalianMutationnot applicablePromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
VKG1-gRNA-pX330
Plasmid#108671PurposeCleavage of VKG1 sequence by CRISPR/Cas9DepositorInsertgRNA for VKG1 sequence
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-2XMS2
Plasmid#75389PurposesgRNA1-2XMS2DepositorInsertsgRNA1-2XMS2
UseCRISPR and LentiviralTagsnoExpressionMammalianMutationPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only