21,213 results
-
Plasmid#19166Purpose3rd gen lentiviral V5-Luciferase expression vector, PGK promoter, BlastDepositorInsertFirefly Luciferase
UseLentiviral and LuciferaseTagsV5ExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-BbTagBY (AAV9)
Viral Prep#45185-AAV9PurposeReady-to-use AAV9 particles produced from AAV-EF1a-BbTagBY (#45185). In addition to the viral particles, you will also receive purified AAV-EF1a-BbTagBY plasmid DNA. Brainbow construct encoding farnesylated TagBFP and EYFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsTagBFP, EYFP, or none.Available SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Antibody#198002-rAbPurposeAnti-DYKDDDDK [M2] chimeric recombinant antibody; binds to FLAG tag sequence. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsImmunocytochemistry and Western BlotReactivitySyntheticSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceApril 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pCMV-MMLVgag-3xNES-ABE8e
Plasmid#181751PurposeMMLV-Gag fused to 3xNES-ABE8e with TSTLLMENSS cleavage site between Gag-NES and ABE. For production of virus like particles with base-editor RNP cargo.DepositorInsertMMLVgag-3xNES-ABE8e
TagsFlagExpressionMammalianPromoterCMVAvailable SinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PS11-scFvFc-CD28-gp41 (706-713)
Plasmid#60606PurposeMammalian Display vectorDepositorAvailable SinceNov. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pWPI
Plasmid#12254Purpose2nd gen bicistronic lentiviral vector allows for simultaneous expression of a transgene and EGFP marker to facilitate tracking of transduced cells.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCre/Lox and LentiviralTagsEMCV IRES-EGFP cassetteExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MbPylRS(DiZPK)
Plasmid#91706Purposeexpress Methanosarcina barkeri pyrrolysyl-tRNA synthetase/tRNA pair in mammalian cells to incorporate the photocrosslinkers DiZPK, DiZSeK, or DiZHSeC into amber codon site on a protein of interestDepositorInsertspylS
pylT
ExpressionMammalianMutationL274A, C313SAvailable SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBE45
Plasmid#174655PurposeCAPTURE method receiver plasmid for Streptomyces heterologous expressionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCGN-HCF-1 fl
Plasmid#53309Purposeplasmid contains human HCFC1 full length gene with HA and c-myc tagsDepositorAvailable SinceMay 28, 2014AvailabilityAcademic Institutions and Nonprofits only