We narrowed to 14,522 results for: SHR
-
Plasmid#198420PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR Human CASP9 -1
Plasmid#198419PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-CMV-mTagBFP2-2A-FLAG-ntcGAS
Plasmid#102603PurposeLentivector to express Flag-tagged and shRNA-resistant cGAS and mTagBFPDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001147319)
Plasmid#75914Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148392)
Plasmid#76362Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
TGMP.shKras.1422
Plasmid#59913PurposeTet on shKras for conditional Kras knockdownDepositorInsertKras (Kras Mouse)
UseRetroviralAvailable SinceDec. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001145974)
Plasmid#75497Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ACTB_sgRNA
Plasmid#183885PurposepX459V2.0-HypaCas9 plasmid with ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001146855)
Plasmid#77886Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162242)
Plasmid#77099Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSMARCA4 guide 2
Plasmid#193605PurposeSMARCA4 knockoutDepositorInsertsgSMARCA4 guide 2 (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148103)
Plasmid#75498Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only