We narrowed to 16,369 results for: gRNA
-
Plasmid#96922Purposefor CRISPRa, lentiviral expression of gRNA scaffold using activator VP64DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pSIH1-puro-STAT3 shRNA
Plasmid#26596DepositorInsertSTAT3 shRNA (STAT3 Human)
UseLentiviral and RNAiAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP
Plasmid#50716Purpose5โ and 3โ EGFP fragments that shares 482bp were placed under ubiquitous CAG promoter. Used for validation of gRNA sequences by DSB mediated EGFP reconstitution.DepositorInsertsplit EGFP
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceFeb. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX552-rScn2a-3xV5-Syn-miRFP670
Plasmid#182566PurposeFor rat Nav1.2 knockin with 3xV5 at the extracellular loopDepositorInsertsrat Scn2a gRNA and 3xV5 donor DNA
miRFP670
UseAAV and CRISPRPromoterSyn and U6Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pADH99
Plasmid#90979PurposeNAT-marked CAS9 expression construct; part 1 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH100-series gRNA expression constructs.DepositorInsertsUS_HIS1
FRT
pENO1
C. albicans Cas9
pMAL2
FLP
NAT 1 of 2
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCambia3301-AtU6-MAR1
Plasmid#210757PurposeMutagenesis of the Arabidopsis MAR1 gene for efficient screening.DepositorInsertAtU6-26 pro::MAR1 sgRNA
UseCRISPRExpressionPlantPromoterAtU6-26Available SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJAT31
Plasmid#204291PurposeFor inserting a phiC31 attP site. HDR integrant is marked with ie1-DsRed, which is expressed in abdomen and mouthparts. Second U6 promoter allows use of two different gRNAs in two synthesized arms.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRMPVIR
Plasmid#27994PurposeRetroviral transfer plasmid for Tet-regulated shRNA expression with a minimal CMV promoter. Contains DsRed2 and Venus fluorescent reporters.DepositorInsertTRMPVIR (shRen)
UseRNAi and Retroviral; Fluorescent reportersExpressionMammalianAvailable SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSF278
Plasmid#167673PurposeIntermediate vector for three gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico-shNKCC1
Plasmid#83027Purposeexpresses an shRNA against NKCC1DepositorInsertshNKCC1
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 sgCASP8
Plasmid#211519PurposeDeletes CASP8DepositorInsertsgCASP8
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSF463
Plasmid#167671PurposeIntermediate vector for two gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-L1221
Plasmid#101335Purposenegative control for knockdowns target site: CTTGTCGATGAGAGCGTTTGTDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSF464
Plasmid#167672PurposeIntermediate vector for four gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYZ960
Plasmid#187972PurposeTEF1p-Cas9(noBsmBI)-CYC1t and tRNA-GFP-SUP4t with 2ยต-URA3DepositorInsertCas9 (codon optimized for human)
UseSynthetic BiologyTagsSV40ExpressionYeastPromoterTEF1Available SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup93-SpeI
Plasmid#87331PurposeExpression of shRNA targeting at Nup93DepositorInsertshRNA against human Nup93
UseRNAiExpressionMammalianPromoterH1Available SinceJune 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PTGS1-1
Plasmid#184731PurposeCOX1-KO in HeLaDepositorInsertA gRNA targeting the human COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PTGS1-2
Plasmid#184732PurposeCOX1-KO in HeLaDepositorInsertA gRNA targeting the human COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only