Skip to main content

We narrowed to 2,840 results for: GFP reporter gene

Showing: 1041 - 1060 of 2840 results
  1. SCN1Aprom(1-500)-H2B-GFP

    Plasmid
    #236162
    Purpose
    Fluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start site
    Depositor
    Insert
    H2B (H2BC11 Human)
    Tags
    EGFP
    Expression
    Mammalian
    Promoter
    E1b minimal promoter with the SCN1a promoter regi…
    Available Since
    April 9, 2025
    Availability
    Academic Institutions and Nonprofits only
  2. Tol2-U6.3-sgRNA-non-targeting-control -GFP

    Plasmid
    #221844
    Purpose
    Tol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoter
    Depositor
    Inserts
    EGFP
    non-targeting control sgRNA- GCACTGCTACGATCTACACC
    Use
    CRISPR; Tol2 transposon optimised for chick expre…
    Expression
    Mammalian
    Promoter
    GACG and U6.3 chick
    Available Since
    July 31, 2024
    Availability
    Academic Institutions and Nonprofits only
  3. pDual-eGFP(Y203)

    Plasmid
    #63559
    Purpose
    Expression of the Mostaza (yellow) spectral variant of eGFP in bacteria and in mammalian cells. Used as a reporter for gene targeting and recombineering in mammalian cells.
    Depositor
    Insert
    His-T7-eGFP(Y203)
    Use
    Lentiviral
    Tags
    His6 and T7
    Expression
    Bacterial and Mammalian
    Mutation
    Changed threonine at position 203 with respect to…
    Promoter
    CMV-EF1α hybrid (CEF)
    Available Since
    April 15, 2015
    Availability
    Academic Institutions and Nonprofits only
Showing: 1041 - 1060 of 2840 results