We narrowed to 14,332 results for: cas9 genes
-
Plasmid#188554PurposeBinary vector for CRISPR/Cas9 targeted to MpIGPD in Marchantia polymorpha (for Agrobacterium-mediated genetic transformation)DepositorInsertgR085
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRVV700
Plasmid#119017PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRVV609
Plasmid#119014PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRVV688
Plasmid#119015PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRVV689
Plasmid#119016PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rMERTK-HITI
Plasmid#87119PurposeGene correction donor AAV for RCS rat. AAV backbone plasmid including exon 2 of rat Mertk and rMertkgRNA for HITIDepositorInsertU6-rMertksgRNA-Mertk(intron1-2)-nEF-GFPKASH-pA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ1.19 (AAVS1 RNA donor in pCDNA3.1)
Plasmid#238007Purpose300bp donor RNA complementary to Cas9 cut site at AAVS1 (Addgene plasmid #72833) with intronic sequence intervening the 3bp insertion signature (ATC). Can be used to measure RT-DSBR in human cells.DepositorUseRna donor to study rt-dsbrExpressionMammalianMutation3bp insertion signature (ATC) at Cas9 cut site in…PromoterCMVAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pLenti-ACTA2-R179 (WT) (LLH661)
Plasmid#242682PurposePlasmid for expression of ACTA2-R179 (wild-type) cDNA from a lentiviral cassetteDepositorInsertpLenti-ACTA2-R179_cDNA
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Fungal Toolkit for Modular Cloning (FTK)
Plasmid Kit#1000000191PurposeSynthetic biology entry vectors with ready-to-use fungal genetic parts for rapid construction of genetic circuits as well as CRISPR components for efficient genome engineering in filamentous fungi.DepositorAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Ribosomal Proteins
Pooled Library#51045PurposeSub-pool of Sabatini/Lander sgRNA library enriched for ribosomal gene targets.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Unknown Function
Pooled Library#51043PurposeSub-pool of Sabatini/Lander sgRNA library enriched for gene targets of unknown function.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0022
Plasmid#117537PurposeLevel1 Golden Gate Cassette: estended stem sgRNA cassette for SpCas9 targeting NbPDS gene in N. benthamianaDepositorInsertsgRNA (Sp Cas9) - extended stem
ExpressionPlantAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMJ920
Plasmid#42234DepositorInsertCas9
UseCRISPRTagsGFP, HA epitope, and NLS (nuclear localization si…ExpressionMammalianMutationcodon-optimized synthetic DNA sequencePromoterCMVAvailable SinceMarch 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459V2.0_Conc2
Plasmid#134451PurposeEmpty concatemer vector in which 2 sgRNAs can be inserted; with Cas9 + PuroDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKDC.109
Plasmid#227189PurposeT7 IPTG-driven Cas9DepositorInsertSpyCas9
ExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL198
Plasmid#180472PurposeFor expression of Cas9 and gRNAs, multiple gRNAs cloning vectorDepositorTypeEmpty backboneUseCRISPRTagsZmCas9ExpressionPlantAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only