We narrowed to 10,946 results for: ESP
-
Plasmid#198323PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
vPyACR_2164382
Plasmid#153029PurposeAnion-conducting channelrhodopsin of viral origin. Codon-optimized for mammalian expression (human/mouse).DepositorInsertvPyACR_2164382
TagseYFPExpressionMammalianMutationvPyACR_2164382 was C-terminally truncated to incl…PromoterCMV (+ enhancer)Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
vPyACR_21821
Plasmid#153030PurposeAnion-conducting channelrhodopsin of viral origin. Codon-optimized for mammalian expression (human/mouse).DepositorInsertvPyACR_21821
TagseYFPExpressionMammalianMutationvPyACR_21821 was C-terminally truncated to includ…PromoterCMV (+ enhancer)Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMB-KO, S199AzF)-HIS
Plasmid#153445PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode B knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMA-KO, S199AzF)-HIS
Plasmid#153444PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode A knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-GFP
Plasmid#179280PurposeAll in one "tet-on" lentivirus vector that expresses rhesus cytomegalovirus Rh159 fused to an eGFP tag at its cytoplasmic tail. Rh159 is an ER resident protein that binds NKG2D activating ligands.DepositorInsertRh159 fused to eGFP
UseLentiviral; All-in-one "tet" on lentivi…TagseGFPExpressionMammalianPromoterTet Responsive Element 3GAvailabilityAcademic Institutions and Nonprofits only -
anxA2-GFP
Plasmid#107196PurposeExpresses human annexin A2-GFP fusion protein for live cell imagingDepositorInsertannexin A2 (ANXA2 Human)
TagsGreen Fluorescent ProteinExpressionMammalianMutationAla residue 65 in human sequence replaced by Glu …PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAED2
Plasmid#234599PurposeFluorescent reporter of the SOS responseDepositorInsertsmScarlet-I
gfp-mut2
UseReporterExpressionBacterialMutationGFPmut2 was derived from avGFP with the following…PromoterPtet+dnaK P1 and cdaAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-control
Plasmid#213788PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and scramble control guide RNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαs-LgB113
Plasmid#134362PurposeNanoluc complementation assay. Expression of Gαs protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 113 and 114 of Gαs. Addition of the HA epitope at N terminus of Gαs.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-PE2-P2A-BFP
Plasmid#231580PurposeExpresses the PE2 prime-editing machinery fused to BFP (PE2-P2A-BFP), under the control of a TRE3G promoter. This promoter is responsive to doxycycline bound to the rtTA proteinDepositorInsertPE2-P2A-BFP
UseLentiviralTagsP2A-BFPExpressionMammalianPromoterTRE3GAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
R701-X65-527: His6-tev-Hs.CALM1(2-148)
Plasmid#159693PurposeE. coli protein expression of His6-tev-Hs.CALM1(2-148)DepositorAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pATP416-ptetO7-pphlO6-crtYBI
Plasmid#165976PurposeExpresses carotenoid biosynthesis gene in response to 2,4-diacetylphloroglucinol and doxycycline in yeast expressing rtTA and PhlTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pphlO6), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
L4857 dsRedExpress2 reporter, VEGFR2 NTEVp, VEGFR1 CTEVp in PiggyBac Transposon Vector
Plasmid#244187PurposePiggyBac transposon vector for expression of dsRed-Express2 synTF promoter; constitutive expression of VEGFR2 NTEVp chain, VEGFR1 CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRed-Express2 under synTF responsive promoter; VEGFR2 NTEVp chain with WT NTEVp; VEGFR1 CTEVp chain; mNeonGreen-P2A-PuroR
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE-8XGTIIC-DsRED-DD
Plasmid#115798Purposelentiviral, trimethoprim (TMP) regulated YAP promoter activity reporterDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-sfGFP
Plasmid#141184PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) fused with sfGFPDepositorHas ServiceCloning Grade DNAInsertS surface glycoprotein [ Severe acute respiratory syndrome coronavirus 2 ] (S SARS coronavirus 2)
TagsSignal peptide from influenza HA and Superfolder …ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_EGFP
Plasmid#155098PurposeLentiviral backbone for cloning and expression of U6 driven gRNAs with Esp3I/BsmBI cloning sites, puromycin selection and EGFP expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only