We narrowed to 14,957 results for: RING
-
Plasmid#217075PurposeDonor plasmid of hAT-7_PM TransposonDepositorInsertTIRs of hAT-7_PM transposon
ExpressionMammalianAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
VanGlow-GL-DSCP
Plasmid#83338Purposefor Gateway cloning of enhancer elements upstream of the DSCP and GFP::Luciferase(nls) reporter, facilitating qualitative and quantitative analysis of expression in transgenic fly lines and S2 cells.DepositorTypeEmpty backboneUseLuciferaseTagsGFP::Luciferase(nls)ExpressionInsectPromoterDrosophila Synthetic Core PromoterAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ143-ZmUbi
Plasmid#138107PurposeGolden Gate recipient and Gateway entry vector; assembly of 3 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.KAT5
Plasmid#184652PurposeRetroviral expression of mouse Kat5DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-shKcnk13
Plasmid#120721PurposeExpresses GFP and an shRNA targeting Kcnk13 (in pLL3.7)DepositorInsertKcnk13 (Kcnk13 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianPromotermouse U6Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)mGAT1YFP8
Plasmid#41669DepositorInsertMus musculus GABA transporter 1 (Slc6a1 Synthetic, Mouse)
TagsYFPExpressionMammalianMutation“Monomerizing” YFP A206K mutation; 8 C-terminal-m…PromoterCMVAvailable SinceJan. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMX-IY LC3C
Plasmid#89292PurposeFor expression of the mammalian Atg8 protein LC3C without a tagDepositorAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
374 pME-ets1a
Plasmid#49000Purposefull length coding sequence for zebrafish ets1a gene in gateway middle entry vectorDepositorInsertv-ets erythroblastosis virus E26 oncogene homolog 1a (ets1 Zebrafish)
UseGateway middle entryAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pGL3-Tet1 promoter A
Plasmid#63881PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet1DepositorInsertTet1 promoter fragment A
UseLuciferaseExpressionMammalianAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
Plasmid#163698PurposeAAV vector expressing CaMPARI2_F391W primarily in excitatory neurons in rodent cortexDepositorInsertCaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMammalianPromoterCaMKII fragmentAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-TP53
Plasmid#111089PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human TP53 gene.DepositorInsertTP53 (TP53 Human)
ExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1977
Plasmid#49109PurposeAAV plasmid with C8ORF46 (Ple251) promoter driving expression of iCre.DepositorInsertssAAV-Ple251-icre
UseAAVExpressionMammalianPromoterC8ORF46Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_g5-HT3.0mut
Plasmid#208724PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0mut in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0mut
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Tet1 promoter B
Plasmid#63882PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet1DepositorInsertTet1 promoter fragment B
UseLuciferaseExpressionMammalianAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
(194) pcDNA3.1-HA-nEPEA-(EAAAK)4-OGT(4,K852A)
Plasmid#160742PurposeExpresses an inactive truncated OGT (4.5 TPRs, K852A) that can't bind O-GlcNAc fused to the EPEA nanobody. A different nanobody can be inserted by using Sgfl + Sgsl restriction enzymes.DepositorInsertHA-nEPEA-(EAAAK)4-OGT(4,K852A)
TagsHA-TagExpressionMammalianPromoterT7/CMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pLB62_PB_pGK-H2B-mIFP-T2A-rTetR-humanKRAB-zeo
Plasmid#179439PurposeExpresses rTetR-KRAB(human) for gene silencing, integration by PiggybacDepositorInsertH2B-mIFP-T2A-rTetR-KRAB
ExpressionMammalianPromoterpGKAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only