We narrowed to 18,353 results for: multi
-
Plasmid#171086PurposeCo-expresses of ΔC-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOBDepositorTagsHisExpressionBacterialMutationDeleted N-term 26aa and C-term 142aa for mutant e…PromoterT5 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.10/RSV_XS3B-miniXon_Luciferase
Plasmid#217302PurposePlasmid containing the SF3B3-XS3B/Firefly luciferase cassette, a modification of the SF3B3-miniXon system. Translation of Firefly luciferase is controlled by splicing modulation of the SF3B3-XS3B by LDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertXS3B-miniXon
UseLuciferaseExpressionMammalianMutationKozak ATG initiation sequence in middle exonPromoterRSVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Med24-exon minimal CMV pCDNA5
Plasmid#212060PurposeLR vector for integration of Med24-exon into N2a FRT rtTA3 expression cellsDepositorInsertMed24-exon (Med24 Mouse)
ExpressionMammalianAvailable sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-aaAFB2
Plasmid#207839PurposeInducible AFB2 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsatAFB2
mCherry
miniIAA7
VHH-GFP4
Tags3X FLAG-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
piggyBac_rtTA (4th_Gen)_Gateway_IRES_NGN2-2A-PURO_Synapsin-BirA. (pEHA1618)
Plasmid#209084PurposeNgn2 mediated cortical neuron induction, gateway destination, Synapsin promoter BirA ligase expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsExpressionMammalianMutationhuman codon optimizedPromoterhSynAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-dCas13b-ADAR2DD
Plasmid#190913PurposeAddgene #103871 with 3x FLAG on N-terminal of dCas13DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert3X FLAG
UseCRISPRTags3X FLAGExpressionMammalianPromoterCMVAvailable sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-Fluoro-Phe D6
Plasmid#197577PurposeExpression of Methanosarcina barkeri (Mb) Fluoro-Phe D6 tRNA synthetase/Pyl-tRNA pair for the encoding of fluorinated phenylalanine derivatives at TAG codons in HEK293 cellsDepositorInsertsMb Pyl Fluoro-Phe B5 synthetase
Pyl-tRNA (4 copies)
TagsNuclear export sequence + FLAGExpressionMammalianMutationN311A, C313M, V366G, W382TPromoterCMV and U6/H1Available sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Neurexin-1-Beta [N170A/26R]
Plasmid#188207PurposeMammalian Expression Plasmid of anti-Neurexin-1-Beta (Human). Derived from hybridoma N170A/26DepositorInsertanti-Neurexin-1-Beta (Homo sapiens) recombinant mouse monoclonal antibody (NRXN1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBZ191-pU6-sgBFP-CBh-sv40NLS-Cas9-NLS-T2A-mCherry
Plasmid#170183PurposeExpression vector for a sgRNA against BFP and spCas9 linked to mCherry via a T2A peptideDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgBFP
ExpressionMammalianPromoterhU6Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE-SOX17-P2A-Venus-rpEF1a-Zeo
Plasmid#169174PurposepiggyBac transposon to generate a Tet inducible SOX17 expressing cell line. Tet-On inducible when paired with #169175DepositorInsertSOX17-P2A-Venus (SOX17 Human, Synthetic)
UsePiggybac transposonExpressionMammalianPromoterpTREtight (tet-inducible promoter)Available sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-PSD-93/Chapsyn-110 [N18/30R]
Plasmid#177506PurposeMammalian Expression Plasmid of anti-PSD-93/Chapsyn-110 (Rat). Derived from hybridoma N18/30.DepositorInsertanti-PSD-93/Chapsyn-110 (Rattus norvegicus) recombinant mouse monoclonal antibody (Dlg2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable sinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC010.AAV
Plasmid#171175PurposeExpression of Sp.pCas9-dCas9, BBa_J23107-MCP-SoxS(R93A/S101A), and hAAVS1 scRNA on pBBR1-KmR plasmidDepositorInsertshAAVS1 scRNA
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterBBa_J23119 and Sp.pCas9, BBa_J23107Available sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-RaichuEV-Rac1(T17N)
Plasmid#164902PurposeExpresses a Rac1 FRET sensor RaichuEV-Rac1 which contains a dominant negative mutation T17N in the Rac1 domainDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRaichuEV-Rac1 (RAC1 Human)
ExpressionMammalianMutationT17N mutation in the Rac1 domain which make the s…Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Necl-5-ScNeo
Plasmid#170283PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserta recombinant mouse Necl-5 fused to the mScarlet and to the mNeonGreen fluorescent protein (Pvr Mouse, Synthetic)
TagsmScarlet and mNeonGreenExpressionMammalianAvailable sinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPK-351
Plasmid#157921PurposepcDNA-CMV-PIF3MTAD-IRES-PhyBGal4DBDDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsPIF3-MTAD
IRES
PhyB(1-621)-SV40NLS-Gal4DBD
UseSynthetic Biology; OptogeneticsTagsHA tag and SV40NLSExpressionMammalianMutationpif3 1-523PromoterCMVAvailable sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-cGAS R71/75E C396/7A-HA
Plasmid#130920PurposeExpresses human cGAS with R71/75E and C396/397A point mutations; Puromycin selection markerDepositorInserthuman cGAS R71/75E C396/7A
TagsHAExpressionMammalianMutationaa 71 and 75 mutated to glutamate; aa 396 and 397…PromoterCMVAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTG8-Amp-FRT
Plasmid#128277PurposeTIP-LITer2.0-KRAS(G12V) gene circuit with the following architecture: CMV-TetOx2-TetR-LOV-TIP-P2A-KRAS(G12V)-P2AGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsTetR-LOV-TIP
EGFP
KRAS(G12V)
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only