We narrowed to 14,918 results for: mal.3
-
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-EF1α-Luc-C20orf24-3’UTR-VAR
Plasmid#128507PurposeLentiviral constitutive expression of Firefly luciferase under control of 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-C20orf24- C20orf24-3’UTR-VAR
Plasmid#128509PurposeLentiviral constitutive expression of C20orf24 under control of its native 3'UTR of human C20orf24 with variant from COX deficiency patient.DepositorAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs_FLAG-Sfxn1-3 (CG11739)
Plasmid#110642PurposeRetroviral expression of Flag-tagged Drosophila CG11739 in mammalian cellsDepositorInsertCG11739 (CG11739 Fly)
UseRetroviralTagsFLAGExpressionMammalianMutationcodon-optimized cDNA (no amino acid mutations)Available SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAK4-FL-3'UTR-MT2
Plasmid#113093PurposeLuciferase reporter containing PAK4-FL- 3' UTR with the second predicted MiR-199a-3p binding site mutatedDepositorInsertp21 Activated kinase 4 (PAK4 Human)
UseLuciferaseExpressionMammalianMutationSecond predicted miR-199a-3p binding site mutated…PromoterPGKAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAK4-FL-3'UTR-MT-both
Plasmid#113094PurposeLuciferase reporter containing PAK4-FL- 3' UTR with both the predicted MiR-199a-3p binding sites mutatedDepositorInsertp21 Activated kinase 4 (PAK4 Human)
UseLuciferaseExpressionMammalianMutationBoth the predicted miR-199a-3p binding site muta…PromoterPGKAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAK4-3'UTR-BS2
Plasmid#113091PurposeLuciferase reporter containing PAK4 3' UTR with the second predicted MiR-199a-3p bindingDepositorInsertp21 Activated kinase 4 (PAK4 Human)
UseLuciferaseExpressionMammalianMutationnonePromoterPGKAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-3
Plasmid#112843Purposetransient/stable overexpression of the C-terminal domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAK4-3'UTR-BS1
Plasmid#113090PurposeLuciferase reporter containing PAK4 3' UTR with the first predicted MiR-199a-3p binding siteDepositorInsertp21 Activated kinase 4 (PAK4 Human)
UseLuciferaseExpressionMammalianMutationnonePromoterPGKAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459 mDnd1#3
Plasmid#106347Purposesmall guide RNA #3 against RRM-coding region of Dnd1 gene locusDepositorAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
YCe4522 HC_Kan_conn_BsaI-3_p1
Plasmid#100670PurposeEMMA toolkit Assembly connector for second step assemblyDepositorInsertEMMA toolkit Assembly connector for second step assembly
UseSynthetic BiologyAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3645 - human expression plasmid for SpCas9 Cluster 3
Plasmid#101187PurposeHuman expression plasmid for SpCas9 Cluster 3 variant: CMV-T7-hSpCas9-Cluster3(T657A, G658A, W659A, R661A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster3(T657A/G658A/W659A/R661A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationT657A/G658A/W659A/R661APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3629 - human expression plasmid for SpCas9 Cluster 3 + Q926A
Plasmid#101188PurposeHuman expression plasmid for SpCas9 Cluster 3 + Q926A variant: CMV-T7-hSpCas9-Cluster3+Q926A(T657A, G658A, W659A, R661A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster3+Q926A(T657A/G658A/W659A/R661A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationT657A/G658A/W659A/R661A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
CDk4-luciferase fragment 3
Plasmid#86662PurposeLuciferase reporter containing CDK4 promoterDepositorInsertCDK4 promoter (CDK4 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationgenerated from 880 -416 to -658PromoterCDK10Available SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
alpha4-nAChR shRNA (Alpha-4.3)
Plasmid#86652Purposeexpression of shRNA targeting CHRNA4DepositorAvailable SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(-) TRIM30C
Plasmid#87083PurposeMurine homologues of human Trim5DepositorInsertTRIM30C (Trim30c Mouse)
ExpressionMammalianAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(-) TRIM30B
Plasmid#87082PurposeMurine homologues of human Trim5DepositorInsertTRIM30B (Trim30b Mouse)
ExpressionMammalianAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 mCherry Gamma 3
Plasmid#65234PurposeTo study the role of the differential rates of Gβγ translocation in modulating signaling dynamics in a cellDepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only