We narrowed to 23,620 results for: ica;
-
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-nsp13 (SARS-CoV-2)
Plasmid#169190PurposeBaculoviral transfer vector to express GST-nsp13 (SARS-CoV-2) in insect cellsDepositorInsertGST-nsp13 (ORF1ab Synthetic, SARS-CoV-2)
TagsGSTExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
SPECT1-COMP-blac-flag-his
Plasmid#111006PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsporozoite protein essential for cell traversal (SPECT1) (PF3D7_1342500 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
WARP-COMP-blac-flag-his
Plasmid#110989PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertvon Willebrand factor A-domain related protein (WARP) (PF08_0136b Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1463900-COMP-blac-flag-his
Plasmid#110965PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertEF-hand calcium binding domain containing protein, putative (PF3D7_1463900 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAP50-COMP-blac-flag-his
Plasmid#110956PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted acid phosphatase (GAP50) (PF3D7_0918000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET19pps-EndoIV(Thermus Thermophilus)
Plasmid#236048PurposepET19pps-APE1(Thermus Thermophilus)DepositorInsertEndo IV from Thermus thermophilus
TagsHis tag and Histidine tagExpressionBacterialPromoterT7 RNA polymeraseAvailable SinceAug. 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+ΔβH
Plasmid#229704PurposeTransient expression of GFP-alpha-cateninA+deltabetaH in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pME463
Plasmid#238103PurposeExpressed ME-ABE ABE7.10-HK with SpRYCas9DepositorInsertTadA*7.10(Y123H/N157K)-m_SpRYnCas9(D10A)
UseCRISPRTagsSV40 bpNLS and SV40 bpNLS-P2A-mCherryExpressionMammalianMutationTadA modifications include Y123H, N157K; SpRY-nCa…Available SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5-blast
Plasmid#208381Purposelentiviral vector for expressing human B3GALT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnucleotide change in PAM targeting sequence nt 51…PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5catdead-blast
Plasmid#220869Purposelentiviral vector for expressing human B3GALT5 with D156A and D243A inactivating mutations and C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationencodes D156A and D243A mutations; also, nucleoti…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-pDUXChd:hDUX4ctd-ca
Plasmid#198237PurposeLentivector with tet-inducible porcine DUXC/human DUX4 chimera (codon altered)DepositorInsertDUX4L pDUXChd:hDUX4ctd (codon altered) (DUX4 Human, S. scrofa (porcine))
UseLentiviralExpressionMammalianMutationcodon alteredPromoterTREAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H170
Plasmid#170352PurposemTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseAdenoviralExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSHDY*in_PpetE:BCD2:MrBBS:Strep
Plasmid#133973PurposeHeterologous, copper-inducible expression of (-)-α- bisabolol synthase from Matricaria recutita (MrBBS) in Synechocystis sp. PCC 6803. The MrBBS CDS is fused to a C-termial StrepII-tag.DepositorInsertMrBBS:StrepII
UseSynthetic BiologyTagsStrepIIExpressionBacterialMutationinserted gene is codon optimized for Synechocyst…PromoterPpetE:BCD2Available SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A ΔWIR
Plasmid#215507PurposeExpresses GFP tagged human ATG2A with the mutation in WIPI interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…Available SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIR
Plasmid#215506PurposeExpresses GFP tagged human ATG2A with the mutation in LC3 interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…Available SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only