We narrowed to 19,677 results for: cat
-
Plasmid#19284DepositorInsertTcf-4 (TCF4 Human)
UseRetroviralTagsFlagMutationDominant negative, lacks N-terminal 41 amino acidsAvailable sinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable sinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pet28a-ClbB-NRPS-NHis
Plasmid#49217PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tagDepositorInsertClbB-NRPS
Tags6x His tag and T7 tagExpressionBacterialMutationcontains aa4-1080 of reference sequence NP_754362…PromoterT7Available sinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPUR-mU6-sgRNA-Sirius-8XPP7
Plasmid#121943PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-8XPP7
UseCRISPR and LentiviralTagsnoExpressionMammalianPromotermouse U6 promoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV5)
Viral prep#112677-AAV5PurposeReady-to-use AAV5 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available sinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET15b-RvLEAMshort
Plasmid#218122PurposeExpresses truncated RvLEAM protein under IPTG induction in bacterial host cells.DepositorInsertRvLEAMshort
Tags6xHISExpressionBacterialMutationTruncated form (58-181aa)PromoterT7Available sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-Trx-mSA2
Plasmid#52320PurposeSolubly expresses monomeric streptavidin containing S25H mutation in E. coli as a thioredoxin fusion. App Microbiol & Biotech 98, 6285-6295 (2014)DepositorInsertmonomeric streptavidin 2
TagsFLAG, His, S tag, TEV site, and ThioredoxinExpressionBacterialMutationS25H mutation compared to streptavidinPromoterT7Available sinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Keratin 18 (pcDNA3)
Plasmid#18064DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKeratin 18 (KRT18 Human)
ExpressionMammalianAvailable sinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSAM_Cam
Plasmid#91570PurposeMariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Lac promoter expresses transposase. Chloramphenicol resistance on backbone.DepositorTypeEmpty backboneExpressionBacterialAvailable sinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3β-FLAG-CBP-LD-HA
Plasmid#32906DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertC/EBP (Crebbp Mouse)
TagsFLAG and HAExpressionMammalianMutationL1435A/D1436APromoterCMVAvailable sinceNov. 18, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
IGF1R_pLX307
Plasmid#98344PurposeLentiviral expression of IGF1RDepositorAvailable sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
3xHA-TurboID pRetrox
Plasmid#155203PurposeFor doxycycline-inducible expression of 3xHA-TurboID on N-terminus of bait proteinDepositorInsert3xHA-TurboID
UseRetroviralTags3xHAExpressionMammalianPromotertight TRE promotorAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP‐RNASEH2A
Plasmid#108700PurposeFor expression of N-terminally eGFP-tagged human RNASEH2A in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRNASEH2A (RNASEH2A Human)
TagsGFPExpressionMammalianPromoterCMVAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
V250 pCEP-4HA B56epsilon
Plasmid#14537DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPPP2R5C B56 epsilon regulatory subunit of PP2A (PPP2R5E Human)
Tags4 HAExpressionMammalianAvailable sinceMarch 23, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDiGi
Plasmid#59323PurposeInducible expression of dsRed and GFP in bacteriaDepositorInsertsEGFP
dsRed
ExpressionBacterialPromoterPbad and PlacAvailable sinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-NGR-WPRE (AAV1)
Viral prep#234441-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-flex-iGluSnFR4s-NGR-WPRE (#234441). In addition to the viral particles, you will also receive purified pAAV-syn-flex-iGluSnFR4s-NGR-WPRE plasmid DNA. Syn-driven, iGluSnFR4s-NGR sensor expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmKalama1-Nuc
Plasmid#14894PurposeMammalian expression of mKalama1 blue fluorescent protein with NLSDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpmKalama1-Nuc
TagsNLSExpressionMammalianMutationI178TPromoterCMVAvailable sinceMay 15, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcrDNA3.1-PRKACA
Plasmid#100890PurposeMammalian expression of PRKACADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertProtein Kinase CAMP-Activated Catalytic Subunit Alpha (PRKACA Human)
ExpressionMammalianMutationIsoform 1 wild typePromoterCMVAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only