We narrowed to 19,227 results for: cat
-
Plasmid#49217PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tagDepositorInsertClbB-NRPS
Tags6x His tag and T7 tagExpressionBacterialMutationcontains aa4-1080 of reference sequence NP_754362…PromoterT7Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAC-ZEAXipi
Plasmid#53287PurposeContains crtE, idi, crtI, crtY, crtB, and crtZ genes of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces zeaxanthin in E. coliDepositorInsertcrtE, idi, crtY, crtI, crtB, crtZ
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
V250 pCEP-4HA B56epsilon
Plasmid#14537DepositorInsertPPP2R5C B56 epsilon regulatory subunit of PP2A (PPP2R5E Human)
Tags4 HAExpressionMammalianAvailable SinceMarch 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
MLV Gag-YFP
Plasmid#1813DepositorAvailable SinceMay 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pDiGi
Plasmid#59323PurposeInducible expression of dsRed and GFP in bacteriaDepositorInsertsEGFP
dsRed
ExpressionBacterialPromoterPbad and PlacAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Actb KI
Plasmid#131479PurposeEndogenous tagging of βactin: N-terminal (amino acid position: D2)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP‐RNASEH2A
Plasmid#108700PurposeFor expression of N-terminally eGFP-tagged human RNASEH2A in mammalian cellsDepositorAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-ArchT-GFP (PV2527) (AAV1)
Viral Prep#99039-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CamKII-ArchT-GFP (PV2527) (#99039). In addition to the viral particles, you will also receive purified pAAV-CamKII-ArchT-GFP (PV2527) plasmid DNA. CaMKII-driven ArchT-GFP expression for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsGFPAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSAM_Cam
Plasmid#91570PurposeMariner transposon mutagenesis & sequencing vector - Transposon contains KanR and Illumina sequencing adapters. Lac promoter expresses transposase. Chloramphenicol resistance on backbone.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTrcAgBIS (CO)
Plasmid#35153DepositorInsertBisabolene Synthase
UseSynthetic BiologyExpressionBacterialPromoterpTrcAvailable SinceMarch 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-DeAct-SpvB
Plasmid#89446PurposeExpresses EGFP-SpvB (Salmonella SpvB 375-591) in mammalian cellsDepositorInsertDeAct-SpvB (spvB Salmonella enterica)
TagsEGFPExpressionMammalianMutationTruncation spanning SpvB amino acids 375-591 (mon…PromoterCMVAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTS118 His14-Avi-28xGS-anti ALFA tag nanobody
Plasmid#199371PurposeBacterial expression plasmid for anti-ALFA nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-ALFA nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myr-(iSH2-p85)-p110alpha-Myc
Plasmid#1410DepositorTagsMycExpressionMammalianPromoterSRalpha promoterAvailable SinceJune 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
p5E-elavl3
Plasmid#82400PurposeGateway-compatible zebrafish elavl3 promoterDepositorInsertelavl3 promoter
Available SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbA5c-MevT(CO)-MBIS(CO, ispA)
Plasmid#35151DepositorInsertAtoB(co)-HMGS(co)-HMGR(co)-MK(co)-PMK(co)-PMD-Idi-IspA
UseSynthetic BiologyExpressionBacterialMutationR364S in Mevalonate KinasePromoterLacUV5,Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV5)
Viral Prep#112677-AAV5PurposeReady-to-use AAV5 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBabe.puro.CDK8.flag
Plasmid#19758DepositorAvailable SinceDec. 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
NLS-Laconic/pCMV-myc-nuc
Plasmid#46307Purposea nuclear-targeted, genetically-encoded sensor for lactateDepositorInsertNLS-Laconic
UseLactate biosensorExpressionMammalianPromoterCMVAvailable SinceAug. 2, 2013AvailabilityAcademic Institutions and Nonprofits only