We narrowed to 3,205 results for: val
-
Plasmid#25967DepositorInsertB-Myb (Mybl2 Mouse)
TagsFlagExpressionBacterialMutationChanged threonines 267, 408, 443, 447 490, 497, 5…Available SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJKW0957
Plasmid#119026PurposeE.coli expression plasmid for PmKOMT1DepositorInsertPmKOMT1
Tags8xHisExpressionBacterialPromoterT7Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUS_A1A
Plasmid#43848DepositorInsertLacZ + BsaI restriction sites
Available SinceMarch 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFUS_A3A
Plasmid#43851DepositorInsertLacZ + BsaI restriction sites
Available SinceMarch 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIVEX-anchor
Plasmid#46844PurposeTemplate for the amplification of spiking anchors in BeSDDepositorTypeEmpty backboneUseIn vitro expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLX317 GFP
Plasmid#193681PurposeConstitutive lentiviral expression of GFPDepositorInsertGFP
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSETA_crE6G2
Plasmid#172929PurposeCrowding FRET sensor with mCerulean3 and mCitrine for E. coli expression. Linker comprises 2 helices, and a 6AA GSG domainDepositorInsertCrowdingSensorE6G2
TagsHisExpressionBacterialMutationVal317Gly, Met316GlyPromoterT7Available SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pV2A-T
Plasmid#153022PurposeSingle-plasmid multi-gene expression system suitable for fungi. The obtained polycistronic gene is expressed under the control of a TetON inducible promoterDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceOct. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGC4593
Plasmid#110206PurposeAccessory plasmid with inducible TEV protease and unnatural tRNA system (AcF)DepositorInsertsTEV protease
aaRS
ExpressionBacterialPromoterPbad and PtetAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIA10.5-Clover
Plasmid#214449PurposeBxbI landing-pad mClover donor. Use with BxbI expressing plasmid to swap payload into 4.721 landing-pad. Generates constitutively expressing cell line.DepositorInsertmClover
ExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTMS1
Plasmid#87799PurposeFor constructing MBP-SUMO-fusion proteins with N-terminal His tag and C-terminal strep II tag using "blunt-end" cloning.DepositorTypeEmpty backboneTags6xHis and Strep IIExpressionBacterialAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTS1
Plasmid#87797PurposeFor constructing SUMO-fusion proteins with N-terminal His tag and C-terminal strep II tag using "blunt-end" cloning.DepositorTypeEmpty backboneTags6xHis and Strep IIExpressionBacterialAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3-enCjCas9-BlastR
Plasmid#220978PurposeExpresses human codon-optimized enCjCas9DepositorInsertenCjCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAPi
Plasmid#127547PurposeGateway-based RNAi vector to clone target gene for silencing in tandem with APT transcript segmentDepositorTypeEmpty backboneUseRNAiPromoterUbiquitinAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFL-EGFP-3xFlag-DEST
Plasmid#134903PurposeBaculovirus co-expression of GFP and gateway cloned protein with 3x-N-terminal Flag tagDepositorTypeEmpty backboneTags3x-FlagExpressionInsectPromoterpolyhedronAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5E-6xgata2aECEbasp
Plasmid#132968Purposegata2a endothelial enhancer (x6) and basal promoter in p5E Gateway vectorDepositorInsertgata2a endothelial enhancer (x6) with a b-actin basal promoter
UseGateway vectorAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIK198
Plasmid#65629Purpose"flipped and extended" sgRNA backbone (Chen et al., 2013) following a C. elegans U6 promoter (Friedland et al., 2013). For Gibson cloning locus-specific sgRNA sequences.DepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
TSC2-S1345D
Plasmid#38107DepositorInserttsc2 (Tsc2 Rat)
TagsGSTExpressionBacterialMutationS1345D (equivalent to S1389D in rat TSC2 isoform …Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only