We narrowed to 58,629 results for: plasmid
-
Plasmid#138340PurposeMammalian expression plasmid for BE4-RrA3FDepositorInsertBE4-RrA3F
TagsBP-NLSExpressionMammalianPromoterCMVAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GWRev_Dest
Plasmid#86954PurposeGateway destination transfer plasmid for making AAV. Contains a DIO cassette for cre-induction. With cre, insert will flip backwards, causing it to turn off (cre-off)DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRQR-P2A-EGFP (RTW3161)
Plasmid#139992PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRQR=D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-xCas9(3.7)-P2A-EGFP (RTW4644)
Plasmid#140004PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with xCas9(3.7)(D10A/A262T/R324L/S409I/E480K/E543D/M694I/E1219V) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) xCas9(3.7) with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; xCas9(3.7)=A262T/R324L/S409I/E480K/…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-plus
Plasmid#126767PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMGS58
Plasmid#135311PurposeA HygR-P2A-AID cassette to tag the protein of interest with auxin-inducible degron at the n-terminalDepositorInsertHygR-P2A-AID
UseN terminal tagging plasmidAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDH
Plasmid#133129PurposeA recombinant plasmid expressing mdh (malate dehydrogenase) geneDepositorInsertmalate dehydrogenase gene
ExpressionBacterialPromotermalate dehydrogenase promoterAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-J23111
Plasmid#113149PurposePlasmid constitutively expressing dCas9 proteinDepositorInsertdCas9
ExpressionBacterialMutationD10A & H840AAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGD283
Plasmid#129733PurposeDestination plasmid containing the 35S:XVE estradiol inducible driver and the A-G overhangs for GreenGate cloning of an expression casette for estradiole-inducible expression in plants.DepositorTypeEmpty backboneExpressionPlantAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_His-ZZ-TEV-Lis1
Plasmid#132539PurposePlasmid for insect cell expression of human full-length LIS1 with an N-terminal His-ZZ-LTLT tagDepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shDyn
Plasmid#132716PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Pdyn gene, which encodes dynorphinDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFnCpf1GG
Plasmid#131010PurposeBackbone plasmid for generating CRISPR arrays for FnCas12a. Contains a GFP-dropout cassette and a direct repeat.DepositorInsertsdirect repeat of FnCas12a
GFP expression cassette
UseCRISPRExpressionBacterialAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGS55 (GFP-ARF16-PB1-MCS-P2A-OsTIR1)
Plasmid#129667PurposeA repair construct to express GFP-ARF16-PB1-MCS and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
FRP2374
Plasmid#127579PurposeRepressor plasmid for WTC 846. Encodes TetR and TetR-Tup1, Met15 selection markerDepositorInsertPRnr2_TetR-NLS-TUP1_tCyc1_PtetO7.1_TetR-NLS_tCyc1
UseSynthetic Biology; Shuttle vectorExpressionYeastAvailable SinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
CaMKIV-dCT
Plasmid#126422PurposePlasmid expresses constitutively active form of CaMK IV (C-terminal regulatory domains removed making the enzyme constitutively active)DepositorInsertCalcium/calmodulin-dependent protein kinase type IV (CAMK4 Human)
TagsFLAGExpressionMammalianAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHO_pTEFmut7_CggR_R250A_ble
Plasmid#124585PurposePlasmid for genomic integration of CggR_R250A repressor regulated by the pTEFmut7 promoterDepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKmK.T4
Plasmid#125056PurposeStorage plasmid for K.marxianus terminator; type 4 partDepositorInsertPDC1 terminator
UseSynthetic BiologyExpressionYeastAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pREP4-Luc
Plasmid#124892PurposeThis plasmid contains EBNA sequence.DepositorInsertluc
Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC- VP64-dCas9-VP64-T2A- GFP(No LoxP sites)
Plasmid#66708Purposeexpresses VP64-dCas9-VP64, same plasmid as Addgene 59791 but with LoxP sites removedDepositorInsertS.Pyogenes VP64-dCas9-VP64
UseLentiviral and Synthetic BiologyTagsVP64MutationD10A and H840APromoterhUbCAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only