We narrowed to 47,372 results for: cha;
-
Plasmid#52269PurposeBacterial expression of mouse TDG-K341R C-terminally fused to GyrA intein, SUMO-E2 and GSTDepositorInsertTDG (Tdg Mouse)
TagsGyrA-intein-Ubc9-GSTExpressionBacterialMutationK341R, SUMO acceptor site mutationPromoterT7Available SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
Hoxd13-3'UTR
Plasmid#31525DepositorAvailable SinceOct. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
SNX9-PX (246-376)
Plasmid#119090PurposeBacterial expression of human phox homology (PX) domain, SNX9-PX (246-376)DepositorAvailabilityAcademic Institutions and Nonprofits only -
PI3KC2gamma-PX (1200-1310)
Plasmid#119121PurposeBacterial expression of human phox homology (PX) domain, PI3KC2gamma-PX (1200-1310)DepositorAvailabilityAcademic Institutions and Nonprofits only -
pFSW Doc2beta 6X mutant
Plasmid#128816PurposeTo make virus expressing Doc2beta 6X mutantDepositorInsertDoc2beta (Doc2b Rat)
UseLentiviralTagsIRES-EGFPMutationD163A, D218A, D220N, D303A, D357A, D359APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro
Plasmid#141395PurposeLentiviral expression of SARS-CoV-2 protein; transient expression and generate lentivirusDepositorInserteGFP
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) (AAV1)
Viral Prep#214865-AAV1PurposeReady-to-use AAV1 particles produced from AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) (#214865). In addition to the viral particles, you will also receive purified AiP14871: pAAV-AiE0779m_3xC2-minBG-RiboL1-jGCaMP8s-WPRE3-BGHpA (Alias: CN4871) plasmid DNA. Neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8s under the minBG promoter. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15571: pAAV-AiE1426m-minBG-iCre(R297T)-BGHpA (Alias: CN5571) (AAV2)
Viral Prep#230877-AAV2PurposeReady-to-use AAV2 particles produced from AiP15571: pAAV-AiE1426m-minBG-iCre(R297T)-BGHpA (Alias: CN5571) (#230877). In addition to the viral particles, you will also receive purified AiP15571: pAAV-AiE1426m-minBG-iCre(R297T)-BGHpA (Alias: CN5571) plasmid DNA. minBG-driven expression of iCre(R297T) in striatal Sst-Chodl interneurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP13738 - pAAV-AiE0743m_3xC2-minBG-tdTomato-WPRE3-BGHpA (Alias: CN3738) (AAV2)
Viral Prep#224173-AAV2PurposeReady-to-use AAV2 particles produced from AiP13738 - pAAV-AiE0743m_3xC2-minBG-tdTomato-WPRE3-BGHpA (Alias: CN3738) (#224173). In addition to the viral particles, you will also receive purified AiP13738 - pAAV-AiE0743m_3xC2-minBG-tdTomato-WPRE3-BGHpA (Alias: CN3738) plasmid DNA. minBG-driven expression of tdTomato in striatal cholinergic neurons. These AAV preparations are suitable purity for injection into animals.DepositorTagstdTomatoAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15646: pAAV-AiE1426m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN5646) (AAV2)
Viral Prep#230884-AAV2PurposeReady-to-use AAV2 particles produced from AiP15646: pAAV-AiE1426m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN5646) (#230884). In addition to the viral particles, you will also receive purified AiP15646: pAAV-AiE1426m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN5646) plasmid DNA. minBG-driven expression of SYFP2 in cortical and striatal Sst-Chodl neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP13780: pAAV-AiE0743m_3xC2-minBG-iCre(R297T)-BGHpA (Alias: CN3780) (AAV2)
Viral Prep#214848-AAV2PurposeReady-to-use AAV2 particles produced from AiP13780: pAAV-AiE0743m_3xC2-minBG-iCre(R297T)-BGHpA (Alias: CN3780) (#214848). In addition to the viral particles, you will also receive purified AiP13780: pAAV-AiE0743m_3xC2-minBG-iCre(R297T)-BGHpA (Alias: CN3780) plasmid DNA. minBG-driven expression of iCre(R297T) in striatal cholinergic neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_GCaMP6f (AAV1)
Viral Prep#213939-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe4_GCaMP6f (#213939). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the chandelier cell-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKC117_pLenti_TetOff_MVP_IRES_PABPC1_INT
Plasmid#242113PurposeTet- or Dox-repressible expression of MVP and PABPC1 fused to INT (human PARP4 fragment)DepositorUseLentiviralMutationPABPC1 aa 1-370, PARP4 aa 1562-1724PromoterTRE3GAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M
Plasmid#114180PurposeORAI1 channel with C-terminal YFP, carrying the mutation V107M in the protein 1st transmembrane domain, responsible for a constitutive activity and associated with tubular aggregate myopathy (TAM).DepositorAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PC1575
Plasmid#232088PurposeMammalian expression plasmid for ubiquibody (uAb) cloning backbone. Includes an Esp3I restriction site directly upstream of GSGSG linker and CHIPĪTPR CDS and a C-terminal IRES-mCherry cassette.DepositorInsertuAb with cloning Esp3I restriction site
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG eGFP NLS
Plasmid#170830PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locusDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALENTagsNLSExpressionMammalianPromoterCAGAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 GfaABC1D hM4D mCherry SV40
Plasmid#92286PurposeAAV DREADD expressionDepositorAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 hSCN5A
Plasmid#145374Purposeexpresses human Nav1.5 (WT) in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only