We narrowed to 14,473 results for: cas9 genes
-
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
eA3Ai-max
Plasmid#207166PurposeExpress A3A with an N57G point mutation and an intron in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A (APOBEC3A Human)
TagsCas9-UGI-UGI-NLS and NLSExpressionMammalianMutationN57GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[B]_rescue_construct
Plasmid#190638PurposePuromycin-selectable expression of HA-tagged Dora[T295M] (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationChanged threonine 295 to methioninePromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[A]_rescue_construct
Plasmid#190640PurposePuromycin-selectable expression of HA-tagged truncated Dora (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationTruncated to contain amino acids 1-945PromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA3
Plasmid#172711PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-CfANLN
Plasmid#183837PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in canine cells using CRISPR/Cas9.DepositorInsertCanis familiaris ANLN homology arms with mNeonGreen-linker
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#2
Plasmid#163389PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#1
Plasmid#163388PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#3
Plasmid#163390PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-SQSfl
Plasmid#171010PurposeHiLITR protease with full-length SQS targeting information (ER)DepositorInsertEGFP-uTEV1-SQS(FL)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
CHyMErA Exon-deletion hgRNA Library
Pooled Library#155200PurposeHybrid guide RNA library targeting human alternative cassette exons for deletion and disruptionDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human Brunello kinome pooled library, guides 1-4 in lentiGuide-Puro backbone
Pooled Library#75312PurposeHuman sgRNA library in backbone lentiGuide-Puro targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
Human Brunello kinome pooled library, guides 5-8 in lentiGuide-Puro backbone
Pooled Library#75313PurposeHuman sgRNA library in backbone lentiGuide-Puro targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCut plasmid toolkit
Plasmid Kit#1000000118PurposePlasmids for integrating into well-characterized chromosomal loci to program gene expression in S. cerevisiae.DepositorApplicationGenome EditingVector TypeYeast ExpressionEditing TypeCRISPRAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL90-Nat-2xHO
Plasmid#139069PurposeCRISPR/Cas9 engineering of the HO endonuclease gene with nourseothricin selectionDepositorInsertTwo guide RNAs targeting the HO endonuclease
ExpressionBacterial and YeastPromoterTDH3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrActin-35S
Plasmid#226708PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrActin promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrActin
UseCRISPRAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrActin-UBI
Plasmid#226709PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrActin promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrActin
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
LADL Anchor
Plasmid#127664PurposeEncodes the LADL Anchor (dCas9-CIBN fusion protein) and puromycin resistance both expressed from the EF1a promoterDepositorInsertdCas9-CIBN-2A-Puro
Tags3XFLAGExpressionMammalianMutationCas9 (D10A,H840A) mutantPromoterEF1aAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only