We narrowed to 29,279 results for: Tat
-
Plasmid#107426PurposeExpresses Calcium channel beta4 auxillary subunit in mammalian cellsDepositorAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_PYGL_WT_V5
Plasmid#82991PurposeGateway Donor vector containing PYGL, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJV137
Plasmid#124256PurposeLentiviral vector (pRRL) containing Her2-ITD specific T cell receptorDepositorAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
FRIG-myc-Sema4D-CD4
Plasmid#51606Purposeexpresses myc-tagged Sema4D/CD4 non-cleavable chimera with extracellular Sema4D, intracellular CD4 in lentiviral backboneDepositorInsertSema4D/CD4-FLAG (Sema4d Mouse, Human)
UseLentiviralTagsFLAG and mycExpressionMammalianMutationSema4D amino acids 660-861 were replaced with CD4…PromoterRSVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E/S302D
Plasmid#62531PurposeSerine 300 of Drosha is mutated to glutamic acid and serine 302 is mutated to aspartic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid and serine 302 changed to aspartic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acid and serine 3…Available SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-INPP5E
Plasmid#79561Purposeexpression of mCherry-tagged CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB1-HIF2a-GFP-T2A-Puro
Plasmid#71708PurposeLentiviral expression of HIF2A-GFPDepositorAvailable SinceJan. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB-3xFlag-dCas13-mTET2HxDCD
Plasmid#228235PurposeFor targeted tethering of an inactive mutant (HxD) of the catalytic domain of mouse TET2 using dCas13DepositorInsertsUseCRISPRExpressionMammalianMutationCD (cysteine-rich, dioxygenase domain) truncation…PromoterCAGAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-E55A-ATPIF1
Plasmid#85404PurposeRetroviral vector expressing human ATPIF1 with E55A mutation, which abrogates the interaction between ATPIF1 and the ATP synthaseDepositorInsertATPIF1 (ATP5IF1 Human)
UseRetroviralExpressionMammalianMutationE55A point mutation abrogating the ability of ATP…Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta IC
Plasmid#202422PurposeExpression of GFP-tagged PODXL without intracellular domainDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
p(HA)HIF1alpha(401delta603)R27G
Plasmid#52215Purposemammalian expression of HA tagged HIF1alpha with a deletion of the N-terminal activation domain and R27G mutationDepositorInsertHIF1alpha (401delta603) R27G (HIF1A Human)
TagsHAExpressionMammalianMutationaa 401-603 deleted, removes the oxygen-dependent …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
hKCNQ5(WT).ires.mScarlet-pcDNA3
Plasmid#204361PurposeHeterologous expression in mammalian cell lines or Xenopus oocyte (T7 RNA pol)DepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mHP1gamma
Plasmid#181902PurposeFluorescently tagged HP1gammaDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5)
Plasmid#55799PurposeThis G protein alpha-s mutant exhibits increased affinity for and decreased ability to be activated by Gs-protein-coupled receptors as well as decreased ability to activate adenylyl cyclase.DepositorInsertG protein alpha-s with alpha-i2 substitutions in alpha3/beta5 loop (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T in alpha-s sequ…PromoterCMVAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RIT1_WT
Plasmid#82882PurposeGateway Donor vector containing RIT1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNTKV- Elf5-KI-3'UTR-2A-EYFP-NLS
Plasmid#128833PurposeKnock-in of nuclear EYFP into mouse Elf5 locusDepositorInsertNuclear EYFP into Elf5 locus (Elf5 Mouse)
UseMouse TargetingAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR2-Fv-Fvls-E
Plasmid#15286DepositorInsertFGFR2 kinase, FKBP12v36 (Fgfr2 Mouse)
TagsMyristoylation-targeting domain c-Src (14aa) and …ExpressionMammalianMutationFGFR2 cytoplasmic domain FKBP12 F36VAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only