We narrowed to 12,610 results for: NSI
-
Plasmid#236432Purposetransient overexpression of E2F2 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pDisplay-CMV-GRAB_LoX3-mut
Plasmid#234651PurposeThis plasmid encodes a mutated version of the genetically encoded chemokine biosensor LoX3-1.0, which is designed to be non-responsive to chemokine binding.DepositorInsertGPCR activation-based mutant chemokine CXCL9-11 sensor GRAB_LoX3-mut
ExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMaRSC
Plasmid#89189PurposeThe pMaRS plasmid is the same construct as pMaRSL274G, but contains a T2A-Mcherry sequence appended to the C-terminal of L274GMmMetRS.DepositorInsertFlag-L274G-T2A-mCherry (Mars1 Mouse)
Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1c-C1
Plasmid#131821PurposeExpresses HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is the cytoplasmic mutant causing AML, where…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.2.t1
Plasmid#73546PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.2.t1
pAzFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
CoV2-M-IRES-E
Plasmid#177938PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Membrane and Envelope proteins (original Wuhan Hu1 sequence). Used for generating RNA packaging virus-like particles.DepositorExpressionMammalianAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBOB-HA-Gna14
Plasmid#246002PurposeExpress HA N-terminal tagged mouse Galpha14 transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pORTMAGE-4
Plasmid#72679PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Cam resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-ER-LAR-GECO1
Plasmid#61244PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cellsDepositorInsertLAR-GECO1
TagsER-retention sequence: KDEL and ER-targeting sequ…ExpressionMammalianMutationSubstitutions relative to R-GECO1: V51W/I113V/N35…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBOB-HA-Gna12
Plasmid#246004PurposeExpress HA N-terminal tagged mouse Galpha12 transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-R-GECO1
Plasmid#32444PurposeMammalian expression of Red fluorescent genetically encoded Ca2+ indicator for optical imagingDepositorInsertR-GECO1.0
ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HA E2F1
Plasmid#236431Purposetransient overexpression of E2F1 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-N1_CBP
Plasmid#221903PurposeTransient expression of GFP-tagged CBP in mammalian cellsDepositorAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_on-mEGFP
Plasmid#194694PurposeCMV driven expression of the consitutively active calcium recorder positive control Caprola_on fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_on-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only