We narrowed to 25,809 results for: Spr
-
Plasmid#188774PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CEP135
Plasmid#227287PurposeDonor template for mStayGold insertion into the N-terminus of the CEP135 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CEP135 (Addgene #227286)DepositorInsertCEP135 Homology Arms flanking a mStayGold Tag (CEP135 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188765PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterSFFVAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEcNucC
Plasmid#214050PurposeBacterial expression plasmid for E. coli MS 115-1 NucC, a cA3-responsive nuclease known to cause abortive infection; used as a positive control in the Haliangium ochraceum type III CRISPR-Cas systemDepositorInsertEcNucC
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mNeon-ACTB
Plasmid#207752PurposeDonor template for Puro-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-mNeon-ACTB
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-Luciferase-hvTK-bla
Plasmid#179450PurposeDonor vector to knock in firefly Luciferase C-terminal to human PER2 geneDepositorInsertLuciferase
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
H516 SONIC KrasG12D-IRES-luciferase donor
Plasmid#138178PurposeCRISPR SONIC: Kras G12D luciferase donor plasmid.DepositorInsertKrasG12D (Kras Mouse)
UseNhej donorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244)
Plasmid#160566PurposeGBoligomers for the position [3_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (E3-E4-En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
BE3-P2A-EGFP (pJUL977)
Plasmid#123612PurposeCAG promoter expression plasmid for rAPOBEC1-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP.DepositorInsertBE3-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCAGAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-mClover3-CD4-bla
Plasmid#179448PurposeDonor vector to knock in mClover3 N-terminal to human PER2 geneDepositorInsertmClover3
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-CMV-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188772PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterCMVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR_UCOE-EF1a-dCas9-XTEN80-KRAB(Kox1)-IRES-mCherry
Plasmid#188769PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterEF1aAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
SPACE-VRQR (pRZ5137)
Plasmid#140245PurposeCMV promoter expression plasmid for TadA*(V82G)-nCas9_VRQR-pmCDA1(R187W)-UGI-UGI-P2A-EGFPDepositorInsertSPACE_VRQR
ExpressionMammalianMutationV82G in TadA*, VRQR mutations in SpCas9, D10A in …PromoterCMVAvailable SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only