We narrowed to 25,812 results for: Spr
-
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA Td2
Plasmid#176255PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26-1gRNA-DFR 2.1 (GB1838)
Plasmid#160625PurposeGB-cassette for the expression of a guide RNA targeting the DFR promoter with 2.1 Ms2 aptamer in the 3' of the scaffoldDepositorInsertU6-26-1gRNA-DFR 2.1
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA:scaffold tetraloop MS2 aptamer SAM (GB1436)
Plasmid#160570PurposeA version of scaffold sgRNA with the sequence of MS2 aptamer inside the tetraloop of the scaffoldDepositorInsertsgRNA:scaffold tetraloop MS2 aptamer SAM
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
Plasmid#113696PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1D4-mCherry
Plasmid#73423PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1D4.DepositorInsertPromoter 1D4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1D4 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4A6-mCherry
Plasmid#73424PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4A6.DepositorInsertPromoter 4A6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4A6 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1E4-mCherry
Plasmid#73426PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1E4.DepositorInsertPromoter 1E4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1E4 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1B6-mCherry
Plasmid#73420PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1B6.DepositorInsertPromoter 1B6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1B6 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3H5-mCherry
Plasmid#73419PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3H5.DepositorInsertPromoter 3H5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3H5 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iSAM
Plasmid#211495PurposeAAVS1 targeting vector containing an all-in-one DOX-inducible system for CRISPRaDepositorInsertsUniSAM insert
TET-ON
Neo Resistance
Insulator
UseCRISPR and Synthetic BiologyTagsT2A-mCherry TagExpressionMammalianPromoterEF1a, NA, Splicing acceptor, and TREGV promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDKN1A sgRNA
Plasmid#138189Purpose3rd generation lentiviral gRNA plasmid targeting human CDKN1ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti MS2-P65-HSF1_Hygro
Plasmid#61426Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker NOTE: A version of this plasmid with improved titer is available: Addgene plasmid #89308 lentiMPH v2DepositorInsertMS2-P65-HSF1_2A_Hygro (HSF1 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianMutationN55K in MS2PromoterEF1AAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA-GFP
Plasmid#215489PurposeLentiviral expression and easy visualization of alpha-synuclein in mammalian cellsDepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Cas9-2A-BFP
Plasmid#164662PurposeRetroviral introduction of Cas9 into mammalian cell line coupled to expression of blue fluorescent proteinDepositorInsertsCas9
BFP
UseCRISPR and RetroviralExpressionMammalianPromoterMSSV_LTRAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only