We narrowed to 11,471 results for: AGA
-
Plasmid#185552PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting SOX4DepositorInsertSOX4 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-ΔFbox-pcDNA3.1-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
DHC1 CRISPR
Plasmid#140545PurposeDHC1 tagging CRISPRDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-Twin-Strep
Plasmid#202528PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken β-actin promoterAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-ChRmine-oScarlet-WPRE
Plasmid#183524PurposeOptogeneticsDepositorInsertChRmine-oScarlet
UseAAVPromoterEf1aAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNluc-sgControl
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAED2
Plasmid#234599PurposeFluorescent reporter of the SOS responseDepositorInsertsmScarlet-I
gfp-mut2
UseReporterExpressionBacterialMutationGFPmut2 was derived from avGFP with the following…PromoterPtet+dnaK P1 and cdaAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K164R)
Plasmid#72555PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK164RPromoterE1B minimal promoterAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMega-MaFRSA
Plasmid#200226PurposeThe plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with meta-trifluoromethylphenylalanine..DepositorInsertsPyrrolysyl-tRNA synthetase
pyrrolysyl-tRNA
TagsnoneExpressionBacterialMutationmutated Asparagine 166 to Alanine and Valine 168 …PromoterproK-lacO and tacIAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only