We narrowed to 41,178 results for: kan
-
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEG302-MSI1-ZF
Plasmid#200912PurposeExpress MSI1-ZF108 in Arabidopsis target FWA geneDepositorInsertMSI1 (MSI1 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ18-ZF
Plasmid#200919PurposeExpress JMJ18-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ18 (JMJ18 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-ELF7-ZF
Plasmid#200920PurposeExpress ELF7-ZF108 in Arabidopsis target FWA geneDepositorInsertELF7 (ELF7 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-DMS3-ZF
Plasmid#200921PurposeExpress DMS3-ZF108 in Arabidopsis target FWA geneDepositorInsertDMS3 (DMS3 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH2-ZF
Plasmid#200922PurposeExpress SUVH2-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH2 (SUVH2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH9-ZF
Plasmid#200923PurposeExpress SUVH9-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH9 (SUVH9 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
FX cloning Kit
Plasmid Kit#1000000039PurposeUse fragment exchange (FX) cloning to generate constructs for screening protein expression in several organisms with a variety of N- and C-terminal tags.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeBacterial Expression, Insect Expression, Mammalian Expression, Xenopus Expression, Yeast ExpressionCloning TypeFX CloningAvailable SinceApril 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
R6K_tac_mCherry_ChInt
Plasmid#187382Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette containing IPTG-inducible mCherryDepositorInsertmCherry
ExpressionBacterialAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only