We narrowed to 11,695 results for: nar
-
Plasmid#62522PurposeC-terminal aa851-1374 of Drosha is deletedDepositorInserthuman Drosha with aa 851-1374 deleted (DROSHA Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 851-1374Available SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-21a_2xNLS_FnCpf1_MBP_protein_expression
Plasmid#120801PurposeProtein expression plasmid for 2xNLS FnCpf1 in pET-21a backboneDepositorInsert2xNLS_FnCpf1
UseCRISPRTagsMBP and NLSExpressionBacterialPromoterT7Available SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(214-598)
Plasmid#135440PurposeExpresses SFPQ 214-598 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialPromoterT7Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE3987
Plasmid#137716PurposeExpresses dLbCas12a-RVRR-BE in mammalian cells.DepositorInsertdLbCas12a-RVRR-BE
Tags6xHis, APOBEC-1, SV40 NLS, and UGIExpressionMammalianMutationG532A, K538V, Y542R, K595RPromoterCMVAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(276-535)
Plasmid#135436PurposeExpresses SFPQ 276-535 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialPromoterT7Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQCXIpuro-H3.3K4M-FLAG/HA
Plasmid#128742PurposeExpression of histone H3.3K4M-FLAG/HADepositorAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FnoCas12a-DR-cr in PBCSK-
Plasmid#126642PurposeCloning vector FnoCas12a DR-crRNA for expression in mammalian cellsDepositorInsertFnoCas12a Full Length Direct Repeat crRNA
UseCRISPRExpressionMammalianPromoterU6 PromoterAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA601: pMVP (L3-L2) P2A-Puro + WPRE
Plasmid#121785PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Puro + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
CRY-tTA (B702)
Plasmid#92032PurposeExpresses CRY2 (Full length, mutated NLS) fusion with tTA2 'tet-OFF' transcriptional activatorDepositorInsertCRY2 (CRY2 Mustard Weed)
TagstTA2 (TetR fused to VP64)ExpressionMammalianMutationNLS on CRY2 is mutatedPromoterCMVAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
KN901: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-KRAB
Plasmid#121830PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmNot1_J
Plasmid#146709PurposeInsect Expression of DmNot1DepositorInsertDmNot1 (Not1 Fly)
ExpressionInsectMutationThree non silent mutations N605S, K759M, G1999S a…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
KZ501: pMVP (L3-L2) P2A-Puro + polyA
Plasmid#121780PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Puro + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG802: pMVP (L3-L2) V5 epitope tag + polyA
Plasmid#121755PurposepMVP L3-L2 entry plasmid, contains V5 epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertV5 epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT346.6-H3.3-K4M-bGHpolyA
Plasmid#128743PurposeInducible expression of histone H3.3K4M-FLAG/HADepositorAvailable SinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA501: pMVP (L3-L2) pA; CMV::TETa-pA
Plasmid#121801PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven TETa downstream of gene of interest.DepositorInsertpolyA + CMV::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA001: pMVP (L3-L2) P2A-mCherry + WPRE
Plasmid#121774PurposepMVP L3-L2 entry plasmid, contains mCherry-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term mCherry linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-mCherry + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
ShaCas9
Plasmid#163794PurposeExpresses ShaCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
CNC3 (CASANOVA-C3)
Plasmid#137191PurposeExpresses CNC3 (CASANOVA-C3), a blue light dependent NmeCas9 inhibitory proteinDepositorInsertCNC3 (CASANOVA-C3)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha218-1374
Plasmid#62523PurposeN-terminal aa1-217 of Drosha is deletedDepositorInserthuman Drosha with aa 1-217 deleted (DROSHA Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 1-217Available SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-Drosha270-1374
Plasmid#62524PurposeN-terminal aa1-269 of Drosha is deletedDepositorInserthuman Drosha with aa 1-269 deleted (DROSHA Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 1-269Available SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KH001: pMVP (L3-L2) V5 epitope tag + WPRE
Plasmid#121762PurposepMVP L3-L2 entry plasmid, contains V5 epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsertV5 epitope tag + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(369-598)
Plasmid#135438PurposeExpresses SFPQ 369-598 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialPromoterT7Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
JJ802: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold
Plasmid#121812PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS302D
Plasmid#62529PurposeSerine 302 of Drosha is mutated to aspartic acidDepositorInserthuman Drosha with serine 302 changed to aspartic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 302 to aspartic acidAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E
Plasmid#62528PurposeSerine 300 of Drosha is mutated to glutamic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acidAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
LA102: pMVP (L3-L2) P2A-eYFP + WPRE
Plasmid#121778PurposepMVP L3-L2 entry plasmid, contains eYFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eYFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eYFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KL301: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-p300core
Plasmid#121839PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/p300core scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN-iRS3GG
Plasmid#98858PurposeExpresses pheS cassette (in place of an antisense RNA probe, for golden gate cloning) in E. coli (kanR).DepositorInsertPheS cassette to be selectively replaced by unique asRNA probes
ExpressionBacterialPromoterpBADAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
LA301: pMVP (L3-L2) P2A-Hygro + WPRE
Plasmid#121787PurposepMVP L3-L2 entry plasmid, contains Hygro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Hygro selection marker linked by P2A to gene in lentivirus vectorsDepositorInsertP2A-Hygro + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmMBD1.7G (pc3343)
Plasmid#246870PurposeMammalian expression plasmid of full length MBD1 with pointmutations C289 and 292A. C-terminal tagged to GFPDepositorInsertMBD1 (Mbd1 Mouse)
TagsGFPExpressionMammalianMutationPointmutations C289,292APromoterCMVAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pmRFP-C1-HDAC11 (pc5151)
Plasmid#248141PurposeExpresses RFP-tagged mouse HDAC11 in mammalian cells.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pmRFP-C1-Kat7 (pc5153)
Plasmid#248143PurposeExpresses RFP-tagged mouse Kat7 in mammalian cells.DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MBD1∆CxxC3 pc4783
Plasmid#229748PurposeBacterial expression vector of MBD1 with a deletion of CXXC3 domain. C-terminal tagged to the intein.DepositorInsertMBD1 (Mbd1 Mouse)
TagsInteinExpressionBacterialMutationMBD1 lacking the third CXXC domainPromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MBD4 pc4785
Plasmid#229750PurposeBacterial expression vector of MBD4 C-terminal tagged to the intein.DepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmMBD2.4G pc2841
Plasmid#229561PurposeMammalian expression vector codes for MBD2(aa 235-414) fused c-terminal to GFP.DepositorAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Actin-16×CBS-GK
Plasmid#164278PurposeTranscribe ACTB-16×CBS mRNA as target for VN-dCasE-VC (VN-dEcCas6-VC-GK) in mammalian cellsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtmiR173aTS-B/c
Plasmid#227964PurposeEntry plasmid with AtmiR173aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
AtmiR173aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NbmiR482aTS-B/c
Plasmid#227966PurposeEntry plasmid with NbmiR482aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
NbmiR482aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-FOXA1-T2A-miRFP670
Plasmid#182335PurposeExpresses human FOXA1 and miRFP670 via T2A linker under control of a CMV promoter.DepositorAvailable SinceApril 2, 2025AvailabilityAcademic Institutions and Nonprofits only