We narrowed to 2,481 results for: Clu
-
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLV-SFFV-myc-ATL1-WPRE-UbC-Emerald
Plasmid#225944PurposeLentiviral vector plasmid expressing human atlastin GTPase 1 (ATL1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hMICU1EF
Plasmid#199180PurposeThis plasmid is used to express a EF-hand disabled human MICU1 protein in E. coli. The protein is fused with a maltose binding protein in the N-terminus, and also contains a C-terminal His6 tag.DepositorInsertMICU1 (MICU1 Human)
TagsHis6 and MBP, Thrombin site, TEV siteMutationD421A, E432K, F433W, F453WAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7]K404R
Plasmid#200715PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 to Arg mutation. Used for overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW7 K404 is mutated to Alanine.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta D-Domain
Plasmid#197453PurposeThe plasmid expresses D-domain deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7K404/412/R
Plasmid#200716PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 & 412 to Arg mutation. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW7 K404 and K412 mutated to Alanines.PromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pro-Il1b-C-Flag
Plasmid#75131PurposeExpresses C-terminal flag-tagged pro-IL-1β in mammalian cellsDepositorInsertinterleukin 1 beta (Il1b Mouse)
Tags3XFLAGExpressionMammalianMutation(please see depositor comments below)PromoterCMVAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-Flag-NLRP3 711-1034
Plasmid#75141PurposeExpresses N-terminal Flag-tagged amino acids 711-1034 of NLRP3 (the LRR domain) in mammalian cellsDepositorInsertNLR family, pyrin domain containing 3 (Nlrp3 Mouse)
TagsFlagExpressionMammalianMutationfragment encoding amino acids 711-1034PromoterCMVAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-Flag-NLRP3 91-710
Plasmid#75140PurposeExpresses N-terminal Flag-tagged amino acids 91-710 of NLRP3 (the nucleotide-binding domain) in mammalian cellsDepositorInsertNLR family, pyrin domain containing 3 (Nlrp3 Mouse)
TagsFlagExpressionMammalianMutationfragment encoding amino acids 91-710PromoterCMVAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninWT
Plasmid#229709PurposeTransient expression of GFP-alpha-cateninWT in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP core
Plasmid#179543Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertS. Pyogenes dCas9 with c-terminal human CBP core (aa 1084-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FUS/TLS-FLAGC
Plasmid#60362PurposePlasmid for expression of FLAG-GFP tagged human FUS/TLS (C-terminal tag). Confers resistance to G418.DepositorAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only